Incidental Mutation 'R5149:Cyp2j5'
ID395238
Institutional Source Beutler Lab
Gene Symbol Cyp2j5
Ensembl Gene ENSMUSG00000052520
Gene Namecytochrome P450, family 2, subfamily j, polypeptide 5
Synonyms
MMRRC Submission 042732-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R5149 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location96628773-96664154 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 96659507 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 166 (L166P)
Ref Sequence ENSEMBL: ENSMUSP00000030299 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030299]
Predicted Effect probably damaging
Transcript: ENSMUST00000030299
AA Change: L166P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030299
Gene: ENSMUSG00000052520
AA Change: L166P

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:p450 44 497 2.3e-140 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Female mice homozygous for a null mutation display increased systolic blood pressure, increased left ventricular weight, decreased litter sizes, decreased serum estrogen levels, and increased induced vasoconstriction responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahsg A G 16: 22,898,923 T245A probably benign Het
Akr1c13 G T 13: 4,194,169 V74L probably benign Het
Amt G A 9: 108,301,451 V389I possibly damaging Het
Ankrd26 T C 6: 118,558,996 N159S probably benign Het
Atp1a4 A G 1: 172,232,005 I840T probably damaging Het
Capn1 T C 19: 5,990,334 probably null Het
Col27a1 T C 4: 63,331,427 probably benign Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dchs1 G A 7: 105,755,658 T2559I probably damaging Het
Dnah12 C A 14: 26,850,926 S258* probably null Het
Dpep1 A T 8: 123,200,438 T309S probably benign Het
Epha5 A T 5: 84,150,358 F559L probably damaging Het
Gm3409 T C 5: 146,537,761 I29T possibly damaging Het
Grhl1 CAGAAGAAG CAGAAG 12: 24,612,179 probably benign Het
Gtf3c1 G T 7: 125,668,037 R941S probably damaging Het
Helb C T 10: 120,105,743 E347K probably benign Het
Ighv14-3 A G 12: 114,060,090 S36P probably damaging Het
Klrb1c T A 6: 128,783,707 M211L probably benign Het
Larp7 C T 3: 127,540,811 E510K probably damaging Het
Lrig1 C T 6: 94,628,044 R190Q possibly damaging Het
March6 A G 15: 31,461,994 S863P possibly damaging Het
Mgst2 A G 3: 51,682,537 N132S probably benign Het
Nlgn2 C T 11: 69,825,390 R775H probably damaging Het
Olfr1138 A T 2: 87,737,405 S306R probably benign Het
Olfr135 A C 17: 38,208,317 E24A possibly damaging Het
Olfr804 T C 10: 129,705,508 V210A probably benign Het
Papln A T 12: 83,771,882 probably null Het
Poteg C T 8: 27,481,643 S395L possibly damaging Het
Prox1 T A 1: 190,147,053 I643F possibly damaging Het
Sept4 A G 11: 87,589,245 E211G probably damaging Het
Serpinb6e A G 13: 33,832,485 F422L probably damaging Het
Slc22a19 A G 19: 7,711,138 L19P probably damaging Het
Snf8 G T 11: 96,043,460 A136S probably benign Het
Sparcl1 C T 5: 104,085,763 M573I probably damaging Het
Spta1 A G 1: 174,247,434 T2409A probably damaging Het
Tat A G 8: 109,996,818 S313G probably benign Het
Tep1 A T 14: 50,837,398 C1785* probably null Het
Tmem132b A G 5: 125,622,925 S176G probably damaging Het
Tnfrsf8 T C 4: 145,303,105 R42G possibly damaging Het
Trio T C 15: 27,754,029 D2124G possibly damaging Het
Trp53bp1 A T 2: 121,216,117 D1067E probably benign Het
Tspan13 T C 12: 36,024,066 S24G probably damaging Het
Zdbf2 T C 1: 63,304,903 S814P possibly damaging Het
Zfp213 C A 17: 23,561,399 R49L probably damaging Het
Other mutations in Cyp2j5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Cyp2j5 APN 4 96630775 missense probably damaging 1.00
IGL00670:Cyp2j5 APN 4 96634275 missense probably benign 0.05
IGL00824:Cyp2j5 APN 4 96663923 missense probably benign
IGL01450:Cyp2j5 APN 4 96658690 missense probably damaging 0.99
IGL01621:Cyp2j5 APN 4 96629554 missense probably benign
IGL02639:Cyp2j5 APN 4 96658749 missense probably benign 0.12
IGL03024:Cyp2j5 APN 4 96629523 missense probably benign 0.03
IGL03212:Cyp2j5 APN 4 96663818 missense probably damaging 0.97
aesculapius UTSW 4 96659612 missense possibly damaging 0.95
Kaduceus UTSW 4 96635815 missense probably benign 0.02
R0112:Cyp2j5 UTSW 4 96629523 missense probably benign 0.03
R0626:Cyp2j5 UTSW 4 96659512 missense probably benign 0.01
R1387:Cyp2j5 UTSW 4 96634285 missense probably damaging 1.00
R1638:Cyp2j5 UTSW 4 96635815 missense probably benign 0.02
R1857:Cyp2j5 UTSW 4 96659486 missense possibly damaging 0.88
R1920:Cyp2j5 UTSW 4 96663254 missense probably damaging 1.00
R2149:Cyp2j5 UTSW 4 96641340 missense possibly damaging 0.95
R2213:Cyp2j5 UTSW 4 96659615 missense probably benign 0.09
R4028:Cyp2j5 UTSW 4 96641416 nonsense probably null
R4895:Cyp2j5 UTSW 4 96663110 critical splice donor site probably null
R5132:Cyp2j5 UTSW 4 96629496 missense probably damaging 1.00
R5666:Cyp2j5 UTSW 4 96658693 missense probably benign 0.00
R6676:Cyp2j5 UTSW 4 96635808 missense possibly damaging 0.57
R7328:Cyp2j5 UTSW 4 96663213 missense probably damaging 0.99
R7853:Cyp2j5 UTSW 4 96641419 missense probably benign 0.06
R7943:Cyp2j5 UTSW 4 96659612 missense possibly damaging 0.95
R8016:Cyp2j5 UTSW 4 96658714 missense probably damaging 1.00
R8052:Cyp2j5 UTSW 4 96664004 missense probably benign
R8064:Cyp2j5 UTSW 4 96658711 missense probably damaging 1.00
R8711:Cyp2j5 UTSW 4 96641423 missense possibly damaging 0.94
R8890:Cyp2j5 UTSW 4 96634318 missense probably damaging 1.00
R8929:Cyp2j5 UTSW 4 96658740 missense possibly damaging 0.95
Z1176:Cyp2j5 UTSW 4 96629506 missense probably damaging 1.00
Z1177:Cyp2j5 UTSW 4 96659480 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TAGTCGAGTGCAAAGCCTG -3'
(R):5'- CATGTCTCTAGTATTTGCTGCATG -3'

Sequencing Primer
(F):5'- CATGCAGGCAGTGACTTCTCATAG -3'
(R):5'- CTAATGGCCAGACATGGA -3'
Posted On2016-06-21