Incidental Mutation 'R5149:Gm3409'
ID395244
Institutional Source Beutler Lab
Gene Symbol Gm3409
Ensembl Gene ENSMUSG00000096664
Gene Namepredicted gene 3409
Synonyms
MMRRC Submission 042732-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R5149 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location146537647-146540427 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 146537761 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 29 (I29T)
Ref Sequence ENSEMBL: ENSMUSP00000142652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110597] [ENSMUST00000110599] [ENSMUST00000199142]
Predicted Effect possibly damaging
Transcript: ENSMUST00000110597
AA Change: I29T

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106227
Gene: ENSMUSG00000096664
AA Change: I29T

DomainStartEndE-ValueType
RasGEFN 66 181 1.96e-3 SMART
low complexity region 265 279 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110599
AA Change: I29T

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106229
Gene: ENSMUSG00000096664
AA Change: I29T

DomainStartEndE-ValueType
RasGEFN 66 181 1.96e-3 SMART
low complexity region 265 287 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000199142
AA Change: I29T

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000142652
Gene: ENSMUSG00000096664
AA Change: I29T

DomainStartEndE-ValueType
RasGEFN 66 181 9.5e-6 SMART
low complexity region 269 291 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahsg A G 16: 22,898,923 T245A probably benign Het
Akr1c13 G T 13: 4,194,169 V74L probably benign Het
Amt G A 9: 108,301,451 V389I possibly damaging Het
Ankrd26 T C 6: 118,558,996 N159S probably benign Het
Atp1a4 A G 1: 172,232,005 I840T probably damaging Het
Capn1 T C 19: 5,990,334 probably null Het
Col27a1 T C 4: 63,331,427 probably benign Het
Cyp2j5 A G 4: 96,659,507 L166P probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dchs1 G A 7: 105,755,658 T2559I probably damaging Het
Dnah12 C A 14: 26,850,926 S258* probably null Het
Dpep1 A T 8: 123,200,438 T309S probably benign Het
Epha5 A T 5: 84,150,358 F559L probably damaging Het
Grhl1 CAGAAGAAG CAGAAG 12: 24,612,179 probably benign Het
Gtf3c1 G T 7: 125,668,037 R941S probably damaging Het
Helb C T 10: 120,105,743 E347K probably benign Het
Ighv14-3 A G 12: 114,060,090 S36P probably damaging Het
Klrb1c T A 6: 128,783,707 M211L probably benign Het
Larp7 C T 3: 127,540,811 E510K probably damaging Het
Lrig1 C T 6: 94,628,044 R190Q possibly damaging Het
March6 A G 15: 31,461,994 S863P possibly damaging Het
Mgst2 A G 3: 51,682,537 N132S probably benign Het
Nlgn2 C T 11: 69,825,390 R775H probably damaging Het
Olfr1138 A T 2: 87,737,405 S306R probably benign Het
Olfr135 A C 17: 38,208,317 E24A possibly damaging Het
Olfr804 T C 10: 129,705,508 V210A probably benign Het
Papln A T 12: 83,771,882 probably null Het
Poteg C T 8: 27,481,643 S395L possibly damaging Het
Prox1 T A 1: 190,147,053 I643F possibly damaging Het
Sept4 A G 11: 87,589,245 E211G probably damaging Het
Serpinb6e A G 13: 33,832,485 F422L probably damaging Het
Slc22a19 A G 19: 7,711,138 L19P probably damaging Het
Snf8 G T 11: 96,043,460 A136S probably benign Het
Sparcl1 C T 5: 104,085,763 M573I probably damaging Het
Spta1 A G 1: 174,247,434 T2409A probably damaging Het
Tat A G 8: 109,996,818 S313G probably benign Het
Tep1 A T 14: 50,837,398 C1785* probably null Het
Tmem132b A G 5: 125,622,925 S176G probably damaging Het
Tnfrsf8 T C 4: 145,303,105 R42G possibly damaging Het
Trio T C 15: 27,754,029 D2124G possibly damaging Het
Trp53bp1 A T 2: 121,216,117 D1067E probably benign Het
Tspan13 T C 12: 36,024,066 S24G probably damaging Het
Zdbf2 T C 1: 63,304,903 S814P possibly damaging Het
Zfp213 C A 17: 23,561,399 R49L probably damaging Het
Other mutations in Gm3409
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03403:Gm3409 APN 5 146539524 missense probably benign 0.03
R1928:Gm3409 UTSW 5 146539608 missense probably benign 0.00
R6475:Gm3409 UTSW 5 146537786 missense possibly damaging 0.79
R7299:Gm3409 UTSW 5 146539547 missense probably benign 0.28
R7301:Gm3409 UTSW 5 146539547 missense probably benign 0.28
R7480:Gm3409 UTSW 5 146539501 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACATATGAGGAGGGGCTCTG -3'
(R):5'- ACCCATTACCATAGAGTGATCAG -3'

Sequencing Primer
(F):5'- GGACCTCAGGAAGTGACATTACTTAC -3'
(R):5'- CCATTACCATAGAGTGATCAGTAAGC -3'
Posted On2016-06-21