Incidental Mutation 'R5149:Poteg'
ID395251
Institutional Source Beutler Lab
Gene Symbol Poteg
Ensembl Gene ENSMUSG00000063932
Gene NamePOTE ankyrin domain family, member G
Synonyms
MMRRC Submission 042732-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R5149 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location27447670-27495172 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 27481643 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 395 (S395L)
Ref Sequence ENSEMBL: ENSMUSP00000147760 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081321] [ENSMUST00000209669] [ENSMUST00000210427]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081321
AA Change: S399L

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000080069
Gene: ENSMUSG00000063932
AA Change: S399L

DomainStartEndE-ValueType
ANK 80 109 1.46e-2 SMART
ANK 113 142 7.89e1 SMART
ANK 146 175 3.1e-6 SMART
ANK 179 208 2.81e-4 SMART
ANK 212 241 8.62e1 SMART
ANK 245 273 1.23e3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000209669
AA Change: S337L

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000210427
AA Change: S395L

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahsg A G 16: 22,898,923 T245A probably benign Het
Akr1c13 G T 13: 4,194,169 V74L probably benign Het
Amt G A 9: 108,301,451 V389I possibly damaging Het
Ankrd26 T C 6: 118,558,996 N159S probably benign Het
Atp1a4 A G 1: 172,232,005 I840T probably damaging Het
Capn1 T C 19: 5,990,334 probably null Het
Col27a1 T C 4: 63,331,427 probably benign Het
Cyp2j5 A G 4: 96,659,507 L166P probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dchs1 G A 7: 105,755,658 T2559I probably damaging Het
Dnah12 C A 14: 26,850,926 S258* probably null Het
Dpep1 A T 8: 123,200,438 T309S probably benign Het
Epha5 A T 5: 84,150,358 F559L probably damaging Het
Gm3409 T C 5: 146,537,761 I29T possibly damaging Het
Grhl1 CAGAAGAAG CAGAAG 12: 24,612,179 probably benign Het
Gtf3c1 G T 7: 125,668,037 R941S probably damaging Het
Helb C T 10: 120,105,743 E347K probably benign Het
Ighv14-3 A G 12: 114,060,090 S36P probably damaging Het
Klrb1c T A 6: 128,783,707 M211L probably benign Het
Larp7 C T 3: 127,540,811 E510K probably damaging Het
Lrig1 C T 6: 94,628,044 R190Q possibly damaging Het
March6 A G 15: 31,461,994 S863P possibly damaging Het
Mgst2 A G 3: 51,682,537 N132S probably benign Het
Nlgn2 C T 11: 69,825,390 R775H probably damaging Het
Olfr1138 A T 2: 87,737,405 S306R probably benign Het
Olfr135 A C 17: 38,208,317 E24A possibly damaging Het
Olfr804 T C 10: 129,705,508 V210A probably benign Het
Papln A T 12: 83,771,882 probably null Het
Prox1 T A 1: 190,147,053 I643F possibly damaging Het
Sept4 A G 11: 87,589,245 E211G probably damaging Het
Serpinb6e A G 13: 33,832,485 F422L probably damaging Het
Slc22a19 A G 19: 7,711,138 L19P probably damaging Het
Snf8 G T 11: 96,043,460 A136S probably benign Het
Sparcl1 C T 5: 104,085,763 M573I probably damaging Het
Spta1 A G 1: 174,247,434 T2409A probably damaging Het
Tat A G 8: 109,996,818 S313G probably benign Het
Tep1 A T 14: 50,837,398 C1785* probably null Het
Tmem132b A G 5: 125,622,925 S176G probably damaging Het
Tnfrsf8 T C 4: 145,303,105 R42G possibly damaging Het
Trio T C 15: 27,754,029 D2124G possibly damaging Het
Trp53bp1 A T 2: 121,216,117 D1067E probably benign Het
Tspan13 T C 12: 36,024,066 S24G probably damaging Het
Zdbf2 T C 1: 63,304,903 S814P possibly damaging Het
Zfp213 C A 17: 23,561,399 R49L probably damaging Het
Other mutations in Poteg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Poteg APN 8 27473620 splice site probably benign
IGL01964:Poteg APN 8 27448008 missense probably damaging 0.99
IGL03017:Poteg APN 8 27462041 missense probably benign 0.01
deduction UTSW 8 27458655 intron probably null
R0034:Poteg UTSW 8 27462077 splice site probably benign
R0069:Poteg UTSW 8 27447821 missense probably benign 0.33
R0069:Poteg UTSW 8 27447821 missense probably benign 0.33
R0522:Poteg UTSW 8 27449958 missense possibly damaging 0.95
R0634:Poteg UTSW 8 27473587 missense probably benign 0.20
R0971:Poteg UTSW 8 27447939 missense probably damaging 1.00
R1019:Poteg UTSW 8 27447824 missense possibly damaging 0.46
R1450:Poteg UTSW 8 27447843 missense probably benign 0.27
R1603:Poteg UTSW 8 27448005 start codon destroyed probably null 0.56
R1650:Poteg UTSW 8 27463785 missense probably benign 0.04
R1656:Poteg UTSW 8 27495032 intron probably benign
R1818:Poteg UTSW 8 27450167 nonsense probably null
R2048:Poteg UTSW 8 27456746 missense probably benign 0.39
R2847:Poteg UTSW 8 27481676 missense probably benign 0.10
R2848:Poteg UTSW 8 27481676 missense probably benign 0.10
R2849:Poteg UTSW 8 27481676 missense probably benign 0.10
R4493:Poteg UTSW 8 27480097 missense possibly damaging 0.68
R4967:Poteg UTSW 8 27494981 intron probably benign
R5051:Poteg UTSW 8 27453329 missense possibly damaging 0.78
R5579:Poteg UTSW 8 27448037 missense probably damaging 1.00
R5594:Poteg UTSW 8 27447968 missense probably benign 0.28
R5723:Poteg UTSW 8 27449992 critical splice donor site probably null
R5804:Poteg UTSW 8 27456798 missense probably damaging 1.00
R6685:Poteg UTSW 8 27447905 missense possibly damaging 0.91
R6911:Poteg UTSW 8 27450298 missense probably damaging 0.97
R7044:Poteg UTSW 8 27449895 missense probably damaging 1.00
R7096:Poteg UTSW 8 27473567 missense probably benign 0.00
R7174:Poteg UTSW 8 27453277 missense probably benign 0.36
R7287:Poteg UTSW 8 27453344 missense probably null 0.44
R7560:Poteg UTSW 8 27494960 missense probably benign
R7604:Poteg UTSW 8 27458655 intron probably null
R7740:Poteg UTSW 8 27462024 splice site probably null
R7875:Poteg UTSW 8 27449914 missense probably benign 0.04
R7958:Poteg UTSW 8 27449914 missense probably benign 0.04
X0063:Poteg UTSW 8 27450154 missense probably damaging 1.00
Z1176:Poteg UTSW 8 27447954 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- TTGGAGAGCTGGAAAGACCC -3'
(R):5'- GCTATTTATGAGCCTAGCTTTCAGTTC -3'

Sequencing Primer
(F):5'- GACCCAGCGCCTTATATACTTAG -3'
(R):5'- GATGTCCTGGAACTCACTATGTGAC -3'
Posted On2016-06-21