Incidental Mutation 'R5149:Dpep1'
ID395253
Institutional Source Beutler Lab
Gene Symbol Dpep1
Ensembl Gene ENSMUSG00000019278
Gene Namedipeptidase 1 (renal)
SynonymsMBD
MMRRC Submission 042732-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #R5149 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location123186242-123201812 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 123200438 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 309 (T309S)
Ref Sequence ENSEMBL: ENSMUSP00000019422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000759] [ENSMUST00000019422] [ENSMUST00000127664] [ENSMUST00000212409] [ENSMUST00000212773]
Predicted Effect probably benign
Transcript: ENSMUST00000000759
SMART Domains Protein: ENSMUSP00000000759
Gene: ENSMUSG00000000743

DomainStartEndE-ValueType
Pfam:Snf7 4 174 6.4e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000019422
AA Change: T309S

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000019422
Gene: ENSMUSG00000019278
AA Change: T309S

DomainStartEndE-ValueType
Pfam:Peptidase_M19 25 352 4.1e-122 PFAM
low complexity region 398 410 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000212409
Predicted Effect probably benign
Transcript: ENSMUST00000212773
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a kidney membrane enzyme involved in the metabolism of glutathione and other similar proteins by dipeptide hydrolysis. The encoded protein is known to regulate leukotriene activity by catalyzing the conversion of leukotriene D4 to leukotriene E4. This protein uses zinc as a cofactor and acts as a disulfide-linked homodimer. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for disruption of this gene ar phenotypically normal although defects have been noted in the conversion of leukotriene D4 to leukotrience E4. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahsg A G 16: 22,898,923 T245A probably benign Het
Akr1c13 G T 13: 4,194,169 V74L probably benign Het
Amt G A 9: 108,301,451 V389I possibly damaging Het
Ankrd26 T C 6: 118,558,996 N159S probably benign Het
Atp1a4 A G 1: 172,232,005 I840T probably damaging Het
Capn1 T C 19: 5,990,334 probably null Het
Col27a1 T C 4: 63,331,427 probably benign Het
Cyp2j5 A G 4: 96,659,507 L166P probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dchs1 G A 7: 105,755,658 T2559I probably damaging Het
Dnah12 C A 14: 26,850,926 S258* probably null Het
Epha5 A T 5: 84,150,358 F559L probably damaging Het
Gm3409 T C 5: 146,537,761 I29T possibly damaging Het
Grhl1 CAGAAGAAG CAGAAG 12: 24,612,179 probably benign Het
Gtf3c1 G T 7: 125,668,037 R941S probably damaging Het
Helb C T 10: 120,105,743 E347K probably benign Het
Ighv14-3 A G 12: 114,060,090 S36P probably damaging Het
Klrb1c T A 6: 128,783,707 M211L probably benign Het
Larp7 C T 3: 127,540,811 E510K probably damaging Het
Lrig1 C T 6: 94,628,044 R190Q possibly damaging Het
March6 A G 15: 31,461,994 S863P possibly damaging Het
Mgst2 A G 3: 51,682,537 N132S probably benign Het
Nlgn2 C T 11: 69,825,390 R775H probably damaging Het
Olfr1138 A T 2: 87,737,405 S306R probably benign Het
Olfr135 A C 17: 38,208,317 E24A possibly damaging Het
Olfr804 T C 10: 129,705,508 V210A probably benign Het
Papln A T 12: 83,771,882 probably null Het
Poteg C T 8: 27,481,643 S395L possibly damaging Het
Prox1 T A 1: 190,147,053 I643F possibly damaging Het
Sept4 A G 11: 87,589,245 E211G probably damaging Het
Serpinb6e A G 13: 33,832,485 F422L probably damaging Het
Slc22a19 A G 19: 7,711,138 L19P probably damaging Het
Snf8 G T 11: 96,043,460 A136S probably benign Het
Sparcl1 C T 5: 104,085,763 M573I probably damaging Het
Spta1 A G 1: 174,247,434 T2409A probably damaging Het
Tat A G 8: 109,996,818 S313G probably benign Het
Tep1 A T 14: 50,837,398 C1785* probably null Het
Tmem132b A G 5: 125,622,925 S176G probably damaging Het
Tnfrsf8 T C 4: 145,303,105 R42G possibly damaging Het
Trio T C 15: 27,754,029 D2124G possibly damaging Het
Trp53bp1 A T 2: 121,216,117 D1067E probably benign Het
Tspan13 T C 12: 36,024,066 S24G probably damaging Het
Zdbf2 T C 1: 63,304,903 S814P possibly damaging Het
Zfp213 C A 17: 23,561,399 R49L probably damaging Het
Other mutations in Dpep1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00811:Dpep1 APN 8 123199615 splice site probably benign
IGL02354:Dpep1 APN 8 123200218 missense probably benign
IGL02361:Dpep1 APN 8 123200218 missense probably benign
IGL02527:Dpep1 APN 8 123198748 missense probably damaging 1.00
IGL02723:Dpep1 APN 8 123194149 missense possibly damaging 0.95
R0190:Dpep1 UTSW 8 123200708 missense probably benign 0.21
R1348:Dpep1 UTSW 8 123199160 missense probably benign 0.02
R1719:Dpep1 UTSW 8 123200747 missense possibly damaging 0.67
R2060:Dpep1 UTSW 8 123200391 missense probably damaging 0.99
R2081:Dpep1 UTSW 8 123199378 missense probably damaging 0.97
R2279:Dpep1 UTSW 8 123194144 missense probably benign 0.04
R3931:Dpep1 UTSW 8 123198779 missense possibly damaging 0.73
R4027:Dpep1 UTSW 8 123194153 missense probably benign 0.12
R4836:Dpep1 UTSW 8 123200367 missense probably damaging 1.00
R5007:Dpep1 UTSW 8 123199378 missense probably damaging 0.97
R5268:Dpep1 UTSW 8 123194089 missense probably benign 0.12
R5774:Dpep1 UTSW 8 123199982 missense probably damaging 1.00
R6041:Dpep1 UTSW 8 123200655 missense probably damaging 0.99
R6335:Dpep1 UTSW 8 123200652 missense probably damaging 1.00
R7705:Dpep1 UTSW 8 123200721 missense possibly damaging 0.94
R8130:Dpep1 UTSW 8 123200226 missense probably damaging 1.00
T0975:Dpep1 UTSW 8 123200988 missense probably damaging 0.99
X0005:Dpep1 UTSW 8 123200988 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGTAGTCTGGTGATGGTGAAC -3'
(R):5'- AGGAATGGGCTTTGCAGATG -3'

Sequencing Primer
(F):5'- AGCAACTTTGTGTCCTGTTCAGAC -3'
(R):5'- CTTTGCAGATGGGCCAGTCTC -3'
Posted On2016-06-21