Incidental Mutation 'R5149:Amt'
ID395254
Institutional Source Beutler Lab
Gene Symbol Amt
Ensembl Gene ENSMUSG00000032607
Gene Nameaminomethyltransferase
SynonymsEG434437
MMRRC Submission 042732-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5149 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location108296853-108302302 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 108301451 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 389 (V389I)
Ref Sequence ENSEMBL: ENSMUSP00000035230 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007959] [ENSMUST00000035227] [ENSMUST00000035230] [ENSMUST00000044725] [ENSMUST00000192886] [ENSMUST00000195615]
Predicted Effect probably benign
Transcript: ENSMUST00000007959
SMART Domains Protein: ENSMUSP00000007959
Gene: ENSMUSG00000007815

DomainStartEndE-ValueType
RHO 8 181 1.09e-134 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000035227
Predicted Effect possibly damaging
Transcript: ENSMUST00000035230
AA Change: V389I

PolyPhen 2 Score 0.591 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000035230
Gene: ENSMUSG00000032607
AA Change: V389I

DomainStartEndE-ValueType
Pfam:GCV_T 38 291 7.8e-86 PFAM
Pfam:GCV_T_C 300 392 1.6e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000044725
SMART Domains Protein: ENSMUSP00000045063
Gene: ENSMUSG00000039461

DomainStartEndE-ValueType
Pfam:T_cell_tran_alt 15 122 1.3e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160025
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160675
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162568
Predicted Effect probably benign
Transcript: ENSMUST00000192886
SMART Domains Protein: ENSMUSP00000142002
Gene: ENSMUSG00000039461

DomainStartEndE-ValueType
Pfam:T_cell_tran_alt 15 106 1.5e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193619
Predicted Effect probably benign
Transcript: ENSMUST00000195615
SMART Domains Protein: ENSMUSP00000141592
Gene: ENSMUSG00000039461

DomainStartEndE-ValueType
Pfam:T_cell_tran_alt 15 103 2.9e-39 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of four critical components of the glycine cleavage system. Mutations in this gene have been associated with glycine encephalopathy. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele develop neural tubes defects at high frequency and exhibit prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahsg A G 16: 22,898,923 T245A probably benign Het
Akr1c13 G T 13: 4,194,169 V74L probably benign Het
Ankrd26 T C 6: 118,558,996 N159S probably benign Het
Atp1a4 A G 1: 172,232,005 I840T probably damaging Het
Capn1 T C 19: 5,990,334 probably null Het
Col27a1 T C 4: 63,331,427 probably benign Het
Cyp2j5 A G 4: 96,659,507 L166P probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dchs1 G A 7: 105,755,658 T2559I probably damaging Het
Dnah12 C A 14: 26,850,926 S258* probably null Het
Dpep1 A T 8: 123,200,438 T309S probably benign Het
Epha5 A T 5: 84,150,358 F559L probably damaging Het
Gm3409 T C 5: 146,537,761 I29T possibly damaging Het
Grhl1 CAGAAGAAG CAGAAG 12: 24,612,179 probably benign Het
Gtf3c1 G T 7: 125,668,037 R941S probably damaging Het
Helb C T 10: 120,105,743 E347K probably benign Het
Ighv14-3 A G 12: 114,060,090 S36P probably damaging Het
Klrb1c T A 6: 128,783,707 M211L probably benign Het
Larp7 C T 3: 127,540,811 E510K probably damaging Het
Lrig1 C T 6: 94,628,044 R190Q possibly damaging Het
March6 A G 15: 31,461,994 S863P possibly damaging Het
Mgst2 A G 3: 51,682,537 N132S probably benign Het
Nlgn2 C T 11: 69,825,390 R775H probably damaging Het
Olfr1138 A T 2: 87,737,405 S306R probably benign Het
Olfr135 A C 17: 38,208,317 E24A possibly damaging Het
Olfr804 T C 10: 129,705,508 V210A probably benign Het
Papln A T 12: 83,771,882 probably null Het
Poteg C T 8: 27,481,643 S395L possibly damaging Het
Prox1 T A 1: 190,147,053 I643F possibly damaging Het
Sept4 A G 11: 87,589,245 E211G probably damaging Het
Serpinb6e A G 13: 33,832,485 F422L probably damaging Het
Slc22a19 A G 19: 7,711,138 L19P probably damaging Het
Snf8 G T 11: 96,043,460 A136S probably benign Het
Sparcl1 C T 5: 104,085,763 M573I probably damaging Het
Spta1 A G 1: 174,247,434 T2409A probably damaging Het
Tat A G 8: 109,996,818 S313G probably benign Het
Tep1 A T 14: 50,837,398 C1785* probably null Het
Tmem132b A G 5: 125,622,925 S176G probably damaging Het
Tnfrsf8 T C 4: 145,303,105 R42G possibly damaging Het
Trio T C 15: 27,754,029 D2124G possibly damaging Het
Trp53bp1 A T 2: 121,216,117 D1067E probably benign Het
Tspan13 T C 12: 36,024,066 S24G probably damaging Het
Zdbf2 T C 1: 63,304,903 S814P possibly damaging Het
Zfp213 C A 17: 23,561,399 R49L probably damaging Het
Other mutations in Amt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02657:Amt APN 9 108301380 missense probably damaging 1.00
IGL03277:Amt APN 9 108301219 missense probably benign
R1333:Amt UTSW 9 108301097 missense probably benign 0.04
R1856:Amt UTSW 9 108297162 missense probably damaging 1.00
R3843:Amt UTSW 9 108297221 missense possibly damaging 0.74
R3844:Amt UTSW 9 108297221 missense possibly damaging 0.74
R3903:Amt UTSW 9 108297221 missense possibly damaging 0.74
R3904:Amt UTSW 9 108297221 missense possibly damaging 0.74
R4729:Amt UTSW 9 108300652 missense probably damaging 1.00
R4814:Amt UTSW 9 108299780 missense probably benign
R6000:Amt UTSW 9 108301485 missense probably benign 0.20
R6044:Amt UTSW 9 108297251 missense probably damaging 1.00
R6911:Amt UTSW 9 108301229 critical splice donor site probably null
R6957:Amt UTSW 9 108299833 missense possibly damaging 0.51
R7618:Amt UTSW 9 108299878 missense probably damaging 1.00
R7658:Amt UTSW 9 108297231 missense probably damaging 0.98
R7783:Amt UTSW 9 108297215 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATACTGGCTGGCAGGTGTTC -3'
(R):5'- TAGATAGGATTCTCTCCCCAACCC -3'

Sequencing Primer
(F):5'- CAGGTGTTCAGGATAGGGATAC -3'
(R):5'- GGATTCTCTCCCCAACCCTAAGC -3'
Posted On2016-06-21