Incidental Mutation 'R5149:Or6c6c'
ID 395256
Institutional Source Beutler Lab
Gene Symbol Or6c6c
Ensembl Gene ENSMUSG00000095401
Gene Name olfactory receptor family 6 subfamily C member 6C
Synonyms GA_x6K02T2PULF-11383575-11384519, MOR110-7, Olfr804
MMRRC Submission 042732-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.090) question?
Stock # R5149 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 129540749-129541693 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 129541377 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 210 (V210A)
Ref Sequence ENSEMBL: ENSMUSP00000150132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077312] [ENSMUST00000213331]
AlphaFold Q7TRH7
Predicted Effect probably benign
Transcript: ENSMUST00000077312
AA Change: V210A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000076540
Gene: ENSMUSG00000095401
AA Change: V210A

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 6e-48 PFAM
Pfam:7tm_1 39 288 3.3e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213331
AA Change: V210A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216747
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahsg A G 16: 22,717,673 (GRCm39) T245A probably benign Het
Akr1c13 G T 13: 4,244,168 (GRCm39) V74L probably benign Het
Amt G A 9: 108,178,650 (GRCm39) V389I possibly damaging Het
Ankrd26 T C 6: 118,535,957 (GRCm39) N159S probably benign Het
Atp1a4 A G 1: 172,059,572 (GRCm39) I840T probably damaging Het
Capn1 T C 19: 6,040,364 (GRCm39) probably null Het
Col27a1 T C 4: 63,249,664 (GRCm39) probably benign Het
Cyp2j5 A G 4: 96,547,744 (GRCm39) L166P probably damaging Het
D6Ertd527e C G 6: 87,088,506 (GRCm39) T223S unknown Het
Dchs1 G A 7: 105,404,865 (GRCm39) T2559I probably damaging Het
Dnah12 C A 14: 26,572,883 (GRCm39) S258* probably null Het
Dpep1 A T 8: 123,927,177 (GRCm39) T309S probably benign Het
Epha5 A T 5: 84,298,217 (GRCm39) F559L probably damaging Het
Gm3409 T C 5: 146,474,571 (GRCm39) I29T possibly damaging Het
Grhl1 CAGAAGAAG CAGAAG 12: 24,662,178 (GRCm39) probably benign Het
Gtf3c1 G T 7: 125,267,209 (GRCm39) R941S probably damaging Het
Helb C T 10: 119,941,648 (GRCm39) E347K probably benign Het
Ighv14-3 A G 12: 114,023,710 (GRCm39) S36P probably damaging Het
Klrb1c T A 6: 128,760,670 (GRCm39) M211L probably benign Het
Larp7 C T 3: 127,334,460 (GRCm39) E510K probably damaging Het
Lrig1 C T 6: 94,605,025 (GRCm39) R190Q possibly damaging Het
Marchf6 A G 15: 31,462,140 (GRCm39) S863P possibly damaging Het
Mgst2 A G 3: 51,589,958 (GRCm39) N132S probably benign Het
Nlgn2 C T 11: 69,716,216 (GRCm39) R775H probably damaging Het
Or2n1c A C 17: 38,519,208 (GRCm39) E24A possibly damaging Het
Or5w15 A T 2: 87,567,749 (GRCm39) S306R probably benign Het
Papln A T 12: 83,818,656 (GRCm39) probably null Het
Poteg C T 8: 27,971,671 (GRCm39) S395L possibly damaging Het
Prox1 T A 1: 189,879,250 (GRCm39) I643F possibly damaging Het
Septin4 A G 11: 87,480,071 (GRCm39) E211G probably damaging Het
Serpinb6e A G 13: 34,016,468 (GRCm39) F422L probably damaging Het
Slc22a19 A G 19: 7,688,503 (GRCm39) L19P probably damaging Het
Snf8 G T 11: 95,934,286 (GRCm39) A136S probably benign Het
Sparcl1 C T 5: 104,233,629 (GRCm39) M573I probably damaging Het
Spta1 A G 1: 174,075,000 (GRCm39) T2409A probably damaging Het
Tat A G 8: 110,723,450 (GRCm39) S313G probably benign Het
Tep1 A T 14: 51,074,855 (GRCm39) C1785* probably null Het
Tmem132b A G 5: 125,699,989 (GRCm39) S176G probably damaging Het
Tnfrsf8 T C 4: 145,029,675 (GRCm39) R42G possibly damaging Het
Trio T C 15: 27,754,115 (GRCm39) D2124G possibly damaging Het
Trp53bp1 A T 2: 121,046,598 (GRCm39) D1067E probably benign Het
Tspan13 T C 12: 36,074,065 (GRCm39) S24G probably damaging Het
Zdbf2 T C 1: 63,344,062 (GRCm39) S814P possibly damaging Het
Zfp213 C A 17: 23,780,373 (GRCm39) R49L probably damaging Het
Other mutations in Or6c6c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01613:Or6c6c APN 10 129,541,492 (GRCm39) missense probably benign 0.01
IGL02041:Or6c6c APN 10 129,541,104 (GRCm39) missense probably damaging 1.00
IGL02245:Or6c6c APN 10 129,541,608 (GRCm39) missense probably damaging 1.00
IGL02341:Or6c6c APN 10 129,541,358 (GRCm39) missense probably damaging 0.99
IGL02433:Or6c6c APN 10 129,541,445 (GRCm39) missense probably benign 0.01
authen UTSW 10 129,541,668 (GRCm39) missense probably benign 0.00
R0111:Or6c6c UTSW 10 129,541,146 (GRCm39) missense probably damaging 1.00
R0309:Or6c6c UTSW 10 129,541,008 (GRCm39) missense probably benign 0.38
R0326:Or6c6c UTSW 10 129,541,638 (GRCm39) missense possibly damaging 0.69
R0374:Or6c6c UTSW 10 129,541,516 (GRCm39) missense probably benign 0.00
R1573:Or6c6c UTSW 10 129,541,487 (GRCm39) missense probably damaging 1.00
R1663:Or6c6c UTSW 10 129,541,160 (GRCm39) missense probably benign 0.44
R1778:Or6c6c UTSW 10 129,541,574 (GRCm39) missense probably benign 0.01
R1789:Or6c6c UTSW 10 129,541,476 (GRCm39) missense possibly damaging 0.82
R1906:Or6c6c UTSW 10 129,541,365 (GRCm39) missense probably benign 0.00
R2108:Or6c6c UTSW 10 129,541,490 (GRCm39) missense probably benign
R2211:Or6c6c UTSW 10 129,541,320 (GRCm39) missense probably benign
R2432:Or6c6c UTSW 10 129,540,794 (GRCm39) missense possibly damaging 0.91
R2902:Or6c6c UTSW 10 129,541,320 (GRCm39) missense probably benign
R4114:Or6c6c UTSW 10 129,541,668 (GRCm39) missense probably benign 0.00
R5153:Or6c6c UTSW 10 129,541,026 (GRCm39) missense probably benign 0.05
R5846:Or6c6c UTSW 10 129,540,756 (GRCm39) missense probably damaging 0.99
R6553:Or6c6c UTSW 10 129,540,932 (GRCm39) missense probably benign 0.07
R7676:Or6c6c UTSW 10 129,541,155 (GRCm39) missense possibly damaging 0.63
R8161:Or6c6c UTSW 10 129,540,753 (GRCm39) missense possibly damaging 0.94
R9266:Or6c6c UTSW 10 129,541,547 (GRCm39) missense probably benign 0.17
R9318:Or6c6c UTSW 10 129,541,283 (GRCm39) missense probably benign 0.00
R9334:Or6c6c UTSW 10 129,541,683 (GRCm39) missense probably benign 0.00
R9746:Or6c6c UTSW 10 129,541,208 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CAAAGTGTGCCACCAACTCG -3'
(R):5'- GCAGAGCTACACCTTTAGACACAG -3'

Sequencing Primer
(F):5'- CAGCTCCTGGGTGACTGGATTC -3'
(R):5'- AGACACTCTCTCCCTTGCAGATG -3'
Posted On 2016-06-21