Incidental Mutation 'R5149:Snf8'
ID395259
Institutional Source Beutler Lab
Gene Symbol Snf8
Ensembl Gene ENSMUSG00000006058
Gene NameSNF8, ESCRT-II complex subunit, homolog (S. cerevisiae)
SynonymsD11Moh34
MMRRC Submission 042732-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5149 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location96034885-96047430 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 96043460 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 136 (A136S)
Ref Sequence ENSEMBL: ENSMUSP00000103328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006217] [ENSMUST00000100528] [ENSMUST00000107700]
Predicted Effect probably benign
Transcript: ENSMUST00000006217
AA Change: A136S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000006217
Gene: ENSMUSG00000006058
AA Change: A136S

DomainStartEndE-ValueType
Pfam:EAP30 6 225 7.6e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100528
SMART Domains Protein: ENSMUSP00000098097
Gene: ENSMUSG00000014349

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
low complexity region 49 84 N/A INTRINSIC
UBCc 104 255 2.26e-35 SMART
low complexity region 338 344 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107700
AA Change: A136S

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000103328
Gene: ENSMUSG00000006058
AA Change: A136S

DomainStartEndE-ValueType
Pfam:EAP30 6 230 1.2e-57 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145749
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150946
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156394
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156524
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the endosomal sorting complex required for transport II (ESCRT-II), which regulates the movement of ubiquitinylated transmembrane proteins to the lysosome for degradation. This complex also interacts with the RNA polymerase II elongation factor (ELL) to overcome the repressive effects of ELL on RNA polymerase II activity. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahsg A G 16: 22,898,923 T245A probably benign Het
Akr1c13 G T 13: 4,194,169 V74L probably benign Het
Amt G A 9: 108,301,451 V389I possibly damaging Het
Ankrd26 T C 6: 118,558,996 N159S probably benign Het
Atp1a4 A G 1: 172,232,005 I840T probably damaging Het
Capn1 T C 19: 5,990,334 probably null Het
Col27a1 T C 4: 63,331,427 probably benign Het
Cyp2j5 A G 4: 96,659,507 L166P probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dchs1 G A 7: 105,755,658 T2559I probably damaging Het
Dnah12 C A 14: 26,850,926 S258* probably null Het
Dpep1 A T 8: 123,200,438 T309S probably benign Het
Epha5 A T 5: 84,150,358 F559L probably damaging Het
Gm3409 T C 5: 146,537,761 I29T possibly damaging Het
Grhl1 CAGAAGAAG CAGAAG 12: 24,612,179 probably benign Het
Gtf3c1 G T 7: 125,668,037 R941S probably damaging Het
Helb C T 10: 120,105,743 E347K probably benign Het
Ighv14-3 A G 12: 114,060,090 S36P probably damaging Het
Klrb1c T A 6: 128,783,707 M211L probably benign Het
Larp7 C T 3: 127,540,811 E510K probably damaging Het
Lrig1 C T 6: 94,628,044 R190Q possibly damaging Het
March6 A G 15: 31,461,994 S863P possibly damaging Het
Mgst2 A G 3: 51,682,537 N132S probably benign Het
Nlgn2 C T 11: 69,825,390 R775H probably damaging Het
Olfr1138 A T 2: 87,737,405 S306R probably benign Het
Olfr135 A C 17: 38,208,317 E24A possibly damaging Het
Olfr804 T C 10: 129,705,508 V210A probably benign Het
Papln A T 12: 83,771,882 probably null Het
Poteg C T 8: 27,481,643 S395L possibly damaging Het
Prox1 T A 1: 190,147,053 I643F possibly damaging Het
Sept4 A G 11: 87,589,245 E211G probably damaging Het
Serpinb6e A G 13: 33,832,485 F422L probably damaging Het
Slc22a19 A G 19: 7,711,138 L19P probably damaging Het
Sparcl1 C T 5: 104,085,763 M573I probably damaging Het
Spta1 A G 1: 174,247,434 T2409A probably damaging Het
Tat A G 8: 109,996,818 S313G probably benign Het
Tep1 A T 14: 50,837,398 C1785* probably null Het
Tmem132b A G 5: 125,622,925 S176G probably damaging Het
Tnfrsf8 T C 4: 145,303,105 R42G possibly damaging Het
Trio T C 15: 27,754,029 D2124G possibly damaging Het
Trp53bp1 A T 2: 121,216,117 D1067E probably benign Het
Tspan13 T C 12: 36,024,066 S24G probably damaging Het
Zdbf2 T C 1: 63,304,903 S814P possibly damaging Het
Zfp213 C A 17: 23,561,399 R49L probably damaging Het
Other mutations in Snf8
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0355:Snf8 UTSW 11 96039299 missense probably benign 0.05
R0606:Snf8 UTSW 11 96034973 start gained probably benign
R5719:Snf8 UTSW 11 96041725 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCTCATTTCTCATGGTCTGAC -3'
(R):5'- AGAATTATAGGTGGGTGGGATATCC -3'

Sequencing Primer
(F):5'- CTCATGGTCTGACCTGTTATTTTAG -3'
(R):5'- TGGGATATCCATTCAAGGCC -3'
Posted On2016-06-21