Incidental Mutation 'R5149:Ighv14-3'
ID395263
Institutional Source Beutler Lab
Gene Symbol Ighv14-3
Ensembl Gene ENSMUSG00000095642
Gene Nameimmunoglobulin heavy variable V14-3
SynonymsGm16840
MMRRC Submission 042732-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.287) question?
Stock #R5149 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location114059845-114060321 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 114060090 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 36 (S36P)
Ref Sequence ENSEMBL: ENSMUSP00000100250 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103469]
Predicted Effect probably damaging
Transcript: ENSMUST00000103469
AA Change: S36P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000100250
Gene: ENSMUSG00000095642
AA Change: S36P

DomainStartEndE-ValueType
IGv 36 117 1.14e-30 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahsg A G 16: 22,898,923 T245A probably benign Het
Akr1c13 G T 13: 4,194,169 V74L probably benign Het
Amt G A 9: 108,301,451 V389I possibly damaging Het
Ankrd26 T C 6: 118,558,996 N159S probably benign Het
Atp1a4 A G 1: 172,232,005 I840T probably damaging Het
Capn1 T C 19: 5,990,334 probably null Het
Col27a1 T C 4: 63,331,427 probably benign Het
Cyp2j5 A G 4: 96,659,507 L166P probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dchs1 G A 7: 105,755,658 T2559I probably damaging Het
Dnah12 C A 14: 26,850,926 S258* probably null Het
Dpep1 A T 8: 123,200,438 T309S probably benign Het
Epha5 A T 5: 84,150,358 F559L probably damaging Het
Gm3409 T C 5: 146,537,761 I29T possibly damaging Het
Grhl1 CAGAAGAAG CAGAAG 12: 24,612,179 probably benign Het
Gtf3c1 G T 7: 125,668,037 R941S probably damaging Het
Helb C T 10: 120,105,743 E347K probably benign Het
Klrb1c T A 6: 128,783,707 M211L probably benign Het
Larp7 C T 3: 127,540,811 E510K probably damaging Het
Lrig1 C T 6: 94,628,044 R190Q possibly damaging Het
March6 A G 15: 31,461,994 S863P possibly damaging Het
Mgst2 A G 3: 51,682,537 N132S probably benign Het
Nlgn2 C T 11: 69,825,390 R775H probably damaging Het
Olfr1138 A T 2: 87,737,405 S306R probably benign Het
Olfr135 A C 17: 38,208,317 E24A possibly damaging Het
Olfr804 T C 10: 129,705,508 V210A probably benign Het
Papln A T 12: 83,771,882 probably null Het
Poteg C T 8: 27,481,643 S395L possibly damaging Het
Prox1 T A 1: 190,147,053 I643F possibly damaging Het
Sept4 A G 11: 87,589,245 E211G probably damaging Het
Serpinb6e A G 13: 33,832,485 F422L probably damaging Het
Slc22a19 A G 19: 7,711,138 L19P probably damaging Het
Snf8 G T 11: 96,043,460 A136S probably benign Het
Sparcl1 C T 5: 104,085,763 M573I probably damaging Het
Spta1 A G 1: 174,247,434 T2409A probably damaging Het
Tat A G 8: 109,996,818 S313G probably benign Het
Tep1 A T 14: 50,837,398 C1785* probably null Het
Tmem132b A G 5: 125,622,925 S176G probably damaging Het
Tnfrsf8 T C 4: 145,303,105 R42G possibly damaging Het
Trio T C 15: 27,754,029 D2124G possibly damaging Het
Trp53bp1 A T 2: 121,216,117 D1067E probably benign Het
Tspan13 T C 12: 36,024,066 S24G probably damaging Het
Zdbf2 T C 1: 63,304,903 S814P possibly damaging Het
Zfp213 C A 17: 23,561,399 R49L probably damaging Het
Other mutations in Ighv14-3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4667:Ighv14-3 UTSW 12 114060255 missense probably benign
R4920:Ighv14-3 UTSW 12 114060257 missense probably benign 0.03
R5623:Ighv14-3 UTSW 12 114060090 missense probably damaging 0.98
R7663:Ighv14-3 UTSW 12 114059934 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TCAGATGTCAGGCTGCTGAG -3'
(R):5'- TGAAATTCAGCTGGGTCATCTTC -3'

Sequencing Primer
(F):5'- CTGAGCTGCAGGTAGGCTG -3'
(R):5'- GGTCATCTTCTTCCTGATGGCAG -3'
Posted On2016-06-21