Incidental Mutation 'R5149:Olfr135'
ID395273
Institutional Source Beutler Lab
Gene Symbol Olfr135
Ensembl Gene ENSMUSG00000057801
Gene Nameolfactory receptor 135
SynonymsGA_x6K02T2PSCP-2656648-2657586, MOR256-48
MMRRC Submission 042732-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R5149 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location38204335-38210915 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 38208317 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Alanine at position 24 (E24A)
Ref Sequence ENSEMBL: ENSMUSP00000150535 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076245] [ENSMUST00000213217]
Predicted Effect possibly damaging
Transcript: ENSMUST00000076245
AA Change: E24A

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000075595
Gene: ENSMUSG00000057801
AA Change: E24A

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 7.6e-50 PFAM
Pfam:7tm_1 41 290 9.2e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213217
AA Change: E24A

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahsg A G 16: 22,898,923 T245A probably benign Het
Akr1c13 G T 13: 4,194,169 V74L probably benign Het
Amt G A 9: 108,301,451 V389I possibly damaging Het
Ankrd26 T C 6: 118,558,996 N159S probably benign Het
Atp1a4 A G 1: 172,232,005 I840T probably damaging Het
Capn1 T C 19: 5,990,334 probably null Het
Col27a1 T C 4: 63,331,427 probably benign Het
Cyp2j5 A G 4: 96,659,507 L166P probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dchs1 G A 7: 105,755,658 T2559I probably damaging Het
Dnah12 C A 14: 26,850,926 S258* probably null Het
Dpep1 A T 8: 123,200,438 T309S probably benign Het
Epha5 A T 5: 84,150,358 F559L probably damaging Het
Gm3409 T C 5: 146,537,761 I29T possibly damaging Het
Grhl1 CAGAAGAAG CAGAAG 12: 24,612,179 probably benign Het
Gtf3c1 G T 7: 125,668,037 R941S probably damaging Het
Helb C T 10: 120,105,743 E347K probably benign Het
Ighv14-3 A G 12: 114,060,090 S36P probably damaging Het
Klrb1c T A 6: 128,783,707 M211L probably benign Het
Larp7 C T 3: 127,540,811 E510K probably damaging Het
Lrig1 C T 6: 94,628,044 R190Q possibly damaging Het
March6 A G 15: 31,461,994 S863P possibly damaging Het
Mgst2 A G 3: 51,682,537 N132S probably benign Het
Nlgn2 C T 11: 69,825,390 R775H probably damaging Het
Olfr1138 A T 2: 87,737,405 S306R probably benign Het
Olfr804 T C 10: 129,705,508 V210A probably benign Het
Papln A T 12: 83,771,882 probably null Het
Poteg C T 8: 27,481,643 S395L possibly damaging Het
Prox1 T A 1: 190,147,053 I643F possibly damaging Het
Sept4 A G 11: 87,589,245 E211G probably damaging Het
Serpinb6e A G 13: 33,832,485 F422L probably damaging Het
Slc22a19 A G 19: 7,711,138 L19P probably damaging Het
Snf8 G T 11: 96,043,460 A136S probably benign Het
Sparcl1 C T 5: 104,085,763 M573I probably damaging Het
Spta1 A G 1: 174,247,434 T2409A probably damaging Het
Tat A G 8: 109,996,818 S313G probably benign Het
Tep1 A T 14: 50,837,398 C1785* probably null Het
Tmem132b A G 5: 125,622,925 S176G probably damaging Het
Tnfrsf8 T C 4: 145,303,105 R42G possibly damaging Het
Trio T C 15: 27,754,029 D2124G possibly damaging Het
Trp53bp1 A T 2: 121,216,117 D1067E probably benign Het
Tspan13 T C 12: 36,024,066 S24G probably damaging Het
Zdbf2 T C 1: 63,304,903 S814P possibly damaging Het
Zfp213 C A 17: 23,561,399 R49L probably damaging Het
Other mutations in Olfr135
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Olfr135 APN 17 38208982 missense probably damaging 0.99
IGL01316:Olfr135 APN 17 38208497 missense probably damaging 0.98
IGL01666:Olfr135 APN 17 38208889 missense probably benign 0.11
IGL02096:Olfr135 APN 17 38209183 makesense probably null
R0255:Olfr135 UTSW 17 38208395 missense probably benign
R0630:Olfr135 UTSW 17 38208413 missense probably damaging 0.97
R1185:Olfr135 UTSW 17 38209183 makesense probably null
R1185:Olfr135 UTSW 17 38209183 makesense probably null
R1185:Olfr135 UTSW 17 38209183 makesense probably null
R1279:Olfr135 UTSW 17 38208787 missense probably benign 0.01
R1878:Olfr135 UTSW 17 38208374 missense probably benign 0.03
R1969:Olfr135 UTSW 17 38208464 missense probably damaging 1.00
R2374:Olfr135 UTSW 17 38209067 missense probably damaging 0.97
R3708:Olfr135 UTSW 17 38208283 missense probably benign 0.01
R5025:Olfr135 UTSW 17 38208443 missense probably damaging 1.00
R5093:Olfr135 UTSW 17 38208317 missense possibly damaging 0.92
R5095:Olfr135 UTSW 17 38208317 missense possibly damaging 0.92
R5103:Olfr135 UTSW 17 38208317 missense possibly damaging 0.92
R5104:Olfr135 UTSW 17 38208317 missense possibly damaging 0.92
R5105:Olfr135 UTSW 17 38208317 missense possibly damaging 0.92
R5150:Olfr135 UTSW 17 38208317 missense possibly damaging 0.92
R5344:Olfr135 UTSW 17 38209104 missense probably damaging 1.00
R6608:Olfr135 UTSW 17 38208479 missense probably damaging 1.00
R7300:Olfr135 UTSW 17 38208697 missense possibly damaging 0.76
R7324:Olfr135 UTSW 17 38208716 missense probably benign
R7580:Olfr135 UTSW 17 38209043 missense probably benign 0.11
R8062:Olfr135 UTSW 17 38209174 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATGACATTCCAAGTGTAGAATGCC -3'
(R):5'- TGATGGTCTTTGTAGAGCCCC -3'

Sequencing Primer
(F):5'- GTGTAGAATGCCAACCCTGGATTC -3'
(R):5'- TCTTTGTAGAGCCCCAAAGG -3'
Posted On2016-06-21