Incidental Mutation 'R5150:Unc5c'
ID395292
Institutional Source Beutler Lab
Gene Symbol Unc5c
Ensembl Gene ENSMUSG00000059921
Gene Nameunc-5 netrin receptor C
SynonymsB130051O18Rik, Unc5h3
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5150 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location141465216-141834924 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 141757793 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 225 (I225N)
Ref Sequence ENSEMBL: ENSMUSP00000118212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075282] [ENSMUST00000106236] [ENSMUST00000130636] [ENSMUST00000142762]
Predicted Effect probably damaging
Transcript: ENSMUST00000075282
AA Change: I225N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074758
Gene: ENSMUSG00000059921
AA Change: I225N

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
SCOP:d2fcba2 64 164 9e-3 SMART
IGc2 179 246 2.72e-5 SMART
TSP1 263 314 8.54e-13 SMART
TSP1 319 368 1.18e-6 SMART
transmembrane domain 396 418 N/A INTRINSIC
ZU5 547 650 6.92e-63 SMART
low complexity region 695 704 N/A INTRINSIC
DEATH 857 948 6.68e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106236
AA Change: I225N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101843
Gene: ENSMUSG00000059921
AA Change: I225N

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
SCOP:d2fcba2 64 164 9e-3 SMART
IGc2 179 246 2.72e-5 SMART
TSP1 263 314 8.54e-13 SMART
TSP1 319 368 1.18e-6 SMART
transmembrane domain 377 399 N/A INTRINSIC
ZU5 528 631 6.92e-63 SMART
low complexity region 676 685 N/A INTRINSIC
DEATH 838 929 6.68e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000130636
AA Change: I151N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117487
Gene: ENSMUSG00000059921
AA Change: I151N

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
IGc2 105 172 2.72e-5 SMART
TSP1 189 240 8.54e-13 SMART
TSP1 245 294 1.18e-6 SMART
transmembrane domain 322 344 N/A INTRINSIC
ZU5 473 576 6.92e-63 SMART
low complexity region 621 630 N/A INTRINSIC
DEATH 783 874 6.68e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000142762
AA Change: I225N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118212
Gene: ENSMUSG00000059921
AA Change: I225N

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
SCOP:d2fcba2 64 164 9e-3 SMART
IGc2 179 246 2.72e-5 SMART
TSP1 263 314 8.54e-13 SMART
TSP1 319 368 1.18e-6 SMART
transmembrane domain 396 418 N/A INTRINSIC
ZU5 547 650 6.92e-63 SMART
low complexity region 695 704 N/A INTRINSIC
DEATH 857 948 6.68e-24 SMART
Meta Mutation Damage Score 0.7547 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 93% (57/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the UNC-5 family of netrin receptors. Netrins are secreted proteins that direct axon extension and cell migration during neural development. They are bifunctional proteins that act as attractants for some cell types and as repellents for others, and these opposite actions are thought to be mediated by two classes of receptors. The UNC-5 family of receptors mediate the repellent response to netrin; they are transmembrane proteins containing 2 immunoglobulin (Ig)-like domains and 2 type I thrombospondin motifs in the extracellular region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants exhibit ataxia, and reduced size early in life. Mutants exhibit cerebellar defects including reduced size and ectopic cerebellar cells in the midbrain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110043O21Rik A G 4: 35,193,270 S228P possibly damaging Het
9930021J03Rik C A 19: 29,805,550 A109S probably damaging Het
Adam33 T C 2: 131,053,197 probably benign Het
Ahnak T C 19: 9,010,904 V3184A possibly damaging Het
Aoc1 A G 6: 48,906,150 N320S possibly damaging Het
Bin2 T C 15: 100,645,363 E313G probably damaging Het
Ccdc47 T C 11: 106,205,439 D253G possibly damaging Het
Ccdc73 A G 2: 104,992,039 T778A probably benign Het
Cops3 C A 11: 59,820,013 D377Y probably damaging Het
Cyp4a14 A C 4: 115,493,609 V156G probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Disp1 C A 1: 183,089,499 M452I probably damaging Het
Fam210b T C 2: 172,351,548 Y94H probably damaging Het
Fbxo45 C A 16: 32,246,706 probably benign Het
Flrt2 T A 12: 95,779,203 M105K possibly damaging Het
Gm26558 G A 2: 70,661,312 probably benign Het
Gpr83 T G 9: 14,860,805 L91R probably damaging Het
Greb1l TTTAATAACTT TTT 18: 10,555,950 probably null Het
Hmces T A 6: 87,933,235 probably null Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Ksr2 A C 5: 117,555,009 E174A probably damaging Het
Lats1 A G 10: 7,712,651 T1011A probably benign Het
Lrrc46 T C 11: 97,036,131 D120G probably damaging Het
Ncstn C A 1: 172,067,584 probably benign Het
Neb T C 2: 52,169,118 T6118A probably benign Het
Nipsnap2 A C 5: 129,757,111 M272L probably benign Het
Nlgn2 C T 11: 69,825,390 R775H probably damaging Het
Olfr1284 T A 2: 111,379,253 D84E probably damaging Het
Olfr1309 T A 2: 111,984,021 T18S probably benign Het
Olfr1314 T A 2: 112,092,535 L55F possibly damaging Het
Olfr135 A C 17: 38,208,317 E24A possibly damaging Het
Olfr1474 A T 19: 13,471,430 Q153H probably benign Het
Olfr157 A G 4: 43,836,301 L63P probably damaging Het
Pold1 A G 7: 44,535,832 V750A possibly damaging Het
Prdm11 C T 2: 92,975,472 E378K probably damaging Het
Ptpn9 A G 9: 57,036,670 D276G probably benign Het
Rlf A T 4: 121,148,172 F1204I probably damaging Het
Robo1 C A 16: 72,972,304 T537K possibly damaging Het
Sec31b T A 19: 44,520,531 M670L probably benign Het
Sephs1 T A 2: 4,899,510 V233E possibly damaging Het
Serpinb2 T C 1: 107,523,209 probably null Het
Sf3b3 T C 8: 110,823,376 Q670R possibly damaging Het
Slc8a2 A C 7: 16,145,176 D529A possibly damaging Het
Sva A G 6: 42,042,159 N88D probably benign Het
Tcf15 G T 2: 152,144,131 R169L probably damaging Het
Tfr2 A G 5: 137,574,490 T188A probably benign Het
Tshz1 T A 18: 84,013,215 K1023* probably null Het
Ttc28 A G 5: 111,225,689 N966S probably damaging Het
Ush2a T C 1: 188,451,870 L1457S possibly damaging Het
Zbtb34 G T 2: 33,411,121 H469Q probably damaging Het
Zfp692 T C 11: 58,307,587 M1T probably null Het
Other mutations in Unc5c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Unc5c APN 3 141788940 missense probably damaging 0.99
IGL01089:Unc5c APN 3 141818202 splice site probably benign
IGL01478:Unc5c APN 3 141828451 missense probably damaging 1.00
IGL02083:Unc5c APN 3 141714647 missense probably damaging 0.99
IGL02269:Unc5c APN 3 141788982 missense probably damaging 1.00
IGL02565:Unc5c APN 3 141803919 missense probably damaging 1.00
IGL02973:Unc5c APN 3 141788890 missense probably benign 0.12
R0179:Unc5c UTSW 3 141818067 nonsense probably null
R0309:Unc5c UTSW 3 141733933 missense probably benign 0.01
R0371:Unc5c UTSW 3 141827522 missense probably benign 0.01
R0603:Unc5c UTSW 3 141771102 missense probably damaging 1.00
R0904:Unc5c UTSW 3 141803840 missense probably benign 0.08
R0907:Unc5c UTSW 3 141789033 missense probably damaging 0.99
R1300:Unc5c UTSW 3 141828543 missense possibly damaging 0.94
R1491:Unc5c UTSW 3 141789822 missense probably damaging 1.00
R1494:Unc5c UTSW 3 141827549 missense possibly damaging 0.93
R1674:Unc5c UTSW 3 141757837 missense possibly damaging 0.74
R1676:Unc5c UTSW 3 141757837 missense possibly damaging 0.74
R1726:Unc5c UTSW 3 141818103 missense probably damaging 1.00
R1750:Unc5c UTSW 3 141827517 missense possibly damaging 0.89
R1815:Unc5c UTSW 3 141757757 missense probably damaging 1.00
R2381:Unc5c UTSW 3 141678155 missense probably damaging 1.00
R2394:Unc5c UTSW 3 141678131 missense probably damaging 1.00
R2945:Unc5c UTSW 3 141789974 missense probably damaging 0.97
R4284:Unc5c UTSW 3 141714674 missense probably damaging 1.00
R4285:Unc5c UTSW 3 141714674 missense probably damaging 1.00
R4287:Unc5c UTSW 3 141714674 missense probably damaging 1.00
R4681:Unc5c UTSW 3 141768613 critical splice donor site probably null
R4736:Unc5c UTSW 3 141816931 missense probably benign 0.00
R4740:Unc5c UTSW 3 141816931 missense probably benign 0.00
R4774:Unc5c UTSW 3 141828517 missense probably damaging 1.00
R4862:Unc5c UTSW 3 141789773 missense probably damaging 1.00
R4905:Unc5c UTSW 3 141801310 missense probably benign 0.19
R4921:Unc5c UTSW 3 141788966 missense probably damaging 1.00
R5559:Unc5c UTSW 3 141803787 missense probably damaging 1.00
R5562:Unc5c UTSW 3 141768530 missense probably damaging 1.00
R5643:Unc5c UTSW 3 141678125 missense probably damaging 1.00
R5644:Unc5c UTSW 3 141678125 missense probably damaging 1.00
R5775:Unc5c UTSW 3 141828520 missense probably damaging 1.00
R5912:Unc5c UTSW 3 141789006 missense probably damaging 1.00
R6154:Unc5c UTSW 3 141678153 missense probably damaging 0.97
R6547:Unc5c UTSW 3 141790019 missense probably benign 0.16
R6558:Unc5c UTSW 3 141789729 missense probably damaging 0.98
R7104:Unc5c UTSW 3 141733904 missense probably damaging 1.00
R7113:Unc5c UTSW 3 141801293 missense probably benign 0.00
R7282:Unc5c UTSW 3 141677990 missense probably damaging 0.98
R7317:Unc5c UTSW 3 141789942 missense probably benign 0.00
R7787:Unc5c UTSW 3 141768552 missense probably damaging 1.00
R7873:Unc5c UTSW 3 141827549 missense probably benign 0.04
R7896:Unc5c UTSW 3 141771161 missense possibly damaging 0.73
R7936:Unc5c UTSW 3 141828477 missense possibly damaging 0.48
R8041:Unc5c UTSW 3 141465784 missense possibly damaging 0.92
R8277:Unc5c UTSW 3 141768612 critical splice donor site probably null
R8669:Unc5c UTSW 3 141803943 missense possibly damaging 0.91
X0018:Unc5c UTSW 3 141714739 missense probably damaging 1.00
X0065:Unc5c UTSW 3 141827661 missense probably damaging 1.00
Z1088:Unc5c UTSW 3 141733900 missense probably damaging 1.00
Z1176:Unc5c UTSW 3 141678010 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCTTGGATGCAATTCATAGC -3'
(R):5'- CTGATGATGCATGAGGCTGG -3'

Sequencing Primer
(F):5'- GCATGAAACAATGTTATATACACTGC -3'
(R):5'- GCTGGATATTTTAAAATGCAATGCG -3'
Posted On2016-06-21