Incidental Mutation 'R5150:Cyp4a14'
ID 395295
Institutional Source Beutler Lab
Gene Symbol Cyp4a14
Ensembl Gene ENSMUSG00000028715
Gene Name cytochrome P450, family 4, subfamily a, polypeptide 14
Synonyms
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R5150 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 115343397-115353339 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 115350806 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 156 (V156G)
Ref Sequence ENSEMBL: ENSMUSP00000030487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030487]
AlphaFold O35728
Predicted Effect probably damaging
Transcript: ENSMUST00000030487
AA Change: V156G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000030487
Gene: ENSMUSG00000028715
AA Change: V156G

DomainStartEndE-ValueType
transmembrane domain 15 32 N/A INTRINSIC
Pfam:p450 51 503 5.4e-129 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124412
Meta Mutation Damage Score 0.6456 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 93% (57/61)
MGI Phenotype PHENOTYPE: Male mice homozygous for disruption of this gene display high blood pressure. Blood pressure is elevated in females as well to levels comparable to normotensive males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam33 T C 2: 130,895,117 (GRCm39) probably benign Het
Ahnak T C 19: 8,988,268 (GRCm39) V3184A possibly damaging Het
Aoc1 A G 6: 48,883,084 (GRCm39) N320S possibly damaging Het
Bin2 T C 15: 100,543,244 (GRCm39) E313G probably damaging Het
Brd10 C A 19: 29,782,950 (GRCm39) A109S probably damaging Het
C9orf72 A G 4: 35,193,270 (GRCm39) S228P possibly damaging Het
Ccdc47 T C 11: 106,096,265 (GRCm39) D253G possibly damaging Het
Ccdc73 A G 2: 104,822,384 (GRCm39) T778A probably benign Het
Cops3 C A 11: 59,710,839 (GRCm39) D377Y probably damaging Het
D6Ertd527e C G 6: 87,088,506 (GRCm39) T223S unknown Het
Disp1 C A 1: 182,871,063 (GRCm39) M452I probably damaging Het
Fam210b T C 2: 172,193,468 (GRCm39) Y94H probably damaging Het
Fbxo45 C A 16: 32,065,524 (GRCm39) probably benign Het
Flrt2 T A 12: 95,745,977 (GRCm39) M105K possibly damaging Het
Gm26558 G A 2: 70,491,656 (GRCm39) probably benign Het
Gpr83 T G 9: 14,772,101 (GRCm39) L91R probably damaging Het
Greb1l TTTAATAACTT TTT 18: 10,555,950 (GRCm39) probably null Het
Hmces T A 6: 87,910,217 (GRCm39) probably null Het
Itgb4 C T 11: 115,874,983 (GRCm39) R447W probably benign Het
Ksr2 A C 5: 117,693,074 (GRCm39) E174A probably damaging Het
Lats1 A G 10: 7,588,415 (GRCm39) T1011A probably benign Het
Lrrc46 T C 11: 96,926,957 (GRCm39) D120G probably damaging Het
Ncstn C A 1: 171,895,151 (GRCm39) probably benign Het
Neb T C 2: 52,059,130 (GRCm39) T6118A probably benign Het
Nipsnap2 A C 5: 129,834,175 (GRCm39) M272L probably benign Het
Nlgn2 C T 11: 69,716,216 (GRCm39) R775H probably damaging Het
Or13c7c A G 4: 43,836,301 (GRCm39) L63P probably damaging Het
Or2n1c A C 17: 38,519,208 (GRCm39) E24A possibly damaging Het
Or4f15 T A 2: 111,814,366 (GRCm39) T18S probably benign Het
Or4f61 T A 2: 111,922,880 (GRCm39) L55F possibly damaging Het
Or4g17 T A 2: 111,209,598 (GRCm39) D84E probably damaging Het
Or5b118 A T 19: 13,448,794 (GRCm39) Q153H probably benign Het
Pold1 A G 7: 44,185,256 (GRCm39) V750A possibly damaging Het
Prdm11 C T 2: 92,805,817 (GRCm39) E378K probably damaging Het
Ptpn9 A G 9: 56,943,954 (GRCm39) D276G probably benign Het
Rlf A T 4: 121,005,369 (GRCm39) F1204I probably damaging Het
Robo1 C A 16: 72,769,192 (GRCm39) T537K possibly damaging Het
Sec31b T A 19: 44,508,970 (GRCm39) M670L probably benign Het
Sephs1 T A 2: 4,904,321 (GRCm39) V233E possibly damaging Het
Serpinb2 T C 1: 107,450,939 (GRCm39) probably null Het
Sf3b3 T C 8: 111,550,008 (GRCm39) Q670R possibly damaging Het
Slc8a2 A C 7: 15,879,101 (GRCm39) D529A possibly damaging Het
Sva A G 6: 42,019,093 (GRCm39) N88D probably benign Het
Tcf15 G T 2: 151,986,051 (GRCm39) R169L probably damaging Het
Tfr2 A G 5: 137,572,752 (GRCm39) T188A probably benign Het
Tshz1 T A 18: 84,031,340 (GRCm39) K1023* probably null Het
Ttc28 A G 5: 111,373,555 (GRCm39) N966S probably damaging Het
Unc5c T A 3: 141,463,554 (GRCm39) I225N probably damaging Het
Ush2a T C 1: 188,184,067 (GRCm39) L1457S possibly damaging Het
Zbtb34 G T 2: 33,301,133 (GRCm39) H469Q probably damaging Het
Zfp692 T C 11: 58,198,413 (GRCm39) M1T probably null Het
Other mutations in Cyp4a14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Cyp4a14 APN 4 115,347,149 (GRCm39) splice site probably benign
IGL01539:Cyp4a14 APN 4 115,344,374 (GRCm39) missense possibly damaging 0.71
IGL01802:Cyp4a14 APN 4 115,352,134 (GRCm39) nonsense probably null
IGL02309:Cyp4a14 APN 4 115,348,829 (GRCm39) missense probably damaging 0.99
IGL02330:Cyp4a14 APN 4 115,352,224 (GRCm39) splice site probably benign
IGL03302:Cyp4a14 APN 4 115,348,575 (GRCm39) missense probably benign 0.00
R1037:Cyp4a14 UTSW 4 115,347,193 (GRCm39) missense probably damaging 1.00
R1236:Cyp4a14 UTSW 4 115,349,367 (GRCm39) missense probably benign 0.01
R2132:Cyp4a14 UTSW 4 115,348,588 (GRCm39) missense probably damaging 1.00
R2133:Cyp4a14 UTSW 4 115,348,588 (GRCm39) missense probably damaging 1.00
R2870:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2870:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2871:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2871:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2872:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2872:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2873:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R4015:Cyp4a14 UTSW 4 115,348,331 (GRCm39) missense probably damaging 1.00
R4925:Cyp4a14 UTSW 4 115,353,133 (GRCm39) missense possibly damaging 0.68
R5104:Cyp4a14 UTSW 4 115,353,126 (GRCm39) missense probably damaging 1.00
R5135:Cyp4a14 UTSW 4 115,347,157 (GRCm39) critical splice donor site probably null
R5930:Cyp4a14 UTSW 4 115,348,607 (GRCm39) missense probably damaging 1.00
R5997:Cyp4a14 UTSW 4 115,353,297 (GRCm39) nonsense probably null
R6269:Cyp4a14 UTSW 4 115,348,328 (GRCm39) missense possibly damaging 0.87
R6354:Cyp4a14 UTSW 4 115,344,441 (GRCm39) missense probably damaging 1.00
R6377:Cyp4a14 UTSW 4 115,353,280 (GRCm39) missense probably benign 0.01
R6534:Cyp4a14 UTSW 4 115,347,156 (GRCm39) splice site probably null
R6563:Cyp4a14 UTSW 4 115,349,283 (GRCm39) missense probably benign 0.23
R6751:Cyp4a14 UTSW 4 115,348,391 (GRCm39) missense probably damaging 0.99
R7039:Cyp4a14 UTSW 4 115,348,278 (GRCm39) missense probably benign 0.23
R7125:Cyp4a14 UTSW 4 115,348,358 (GRCm39) missense probably damaging 1.00
R7379:Cyp4a14 UTSW 4 115,350,907 (GRCm39) splice site probably null
R7544:Cyp4a14 UTSW 4 115,348,283 (GRCm39) missense probably damaging 0.98
R7591:Cyp4a14 UTSW 4 115,347,157 (GRCm39) critical splice donor site probably null
R7740:Cyp4a14 UTSW 4 115,350,806 (GRCm39) missense probably damaging 1.00
R7741:Cyp4a14 UTSW 4 115,347,156 (GRCm39) splice site probably null
R7753:Cyp4a14 UTSW 4 115,350,861 (GRCm39) missense probably damaging 1.00
R7789:Cyp4a14 UTSW 4 115,352,107 (GRCm39) missense probably benign 0.00
R8064:Cyp4a14 UTSW 4 115,352,155 (GRCm39) missense probably benign
R8311:Cyp4a14 UTSW 4 115,348,275 (GRCm39) missense probably damaging 1.00
R8458:Cyp4a14 UTSW 4 115,353,129 (GRCm39) missense probably damaging 1.00
R8868:Cyp4a14 UTSW 4 115,348,553 (GRCm39) missense probably damaging 1.00
R9039:Cyp4a14 UTSW 4 115,344,461 (GRCm39) missense probably damaging 0.97
R9632:Cyp4a14 UTSW 4 115,349,347 (GRCm39) missense probably benign 0.00
R9710:Cyp4a14 UTSW 4 115,349,347 (GRCm39) missense probably benign 0.00
Z1176:Cyp4a14 UTSW 4 115,347,214 (GRCm39) missense probably benign 0.01
Z1177:Cyp4a14 UTSW 4 115,348,650 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- ACAGTGCTATCTGAAGTCTGTG -3'
(R):5'- TGTAACCAAATGATTCCAGGGG -3'

Sequencing Primer
(F):5'- CCAATTTATGCATTTGTGGGAGACTC -3'
(R):5'- GTAACCAAATGATTCCAGGGGTACTC -3'
Posted On 2016-06-21