Incidental Mutation 'R5150:Nipsnap2'
ID395299
Institutional Source Beutler Lab
Gene Symbol Nipsnap2
Ensembl Gene ENSMUSG00000029432
Gene Namenipsnap homolog 2
SynonymsGbas, Nipsnap2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5150 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location129725063-129758327 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 129757111 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 272 (M272L)
Ref Sequence ENSEMBL: ENSMUSP00000141131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086046] [ENSMUST00000124342] [ENSMUST00000186265] [ENSMUST00000195946]
Predicted Effect probably benign
Transcript: ENSMUST00000086046
AA Change: M272L

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000083211
Gene: ENSMUSG00000029432
AA Change: M272L

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pfam:NIPSNAP 182 279 2.6e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124342
AA Change: M272L

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000117705
Gene: ENSMUSG00000029432
AA Change: M272L

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pfam:NIPSNAP 182 279 2.8e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135160
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137604
Predicted Effect probably benign
Transcript: ENSMUST00000186265
AA Change: M272L

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000141131
Gene: ENSMUSG00000029432
AA Change: M272L

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pfam:NIPSNAP 182 279 2.8e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195946
SMART Domains Protein: ENSMUSP00000142916
Gene: ENSMUSG00000029432

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Meta Mutation Damage Score 0.0946 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 93% (57/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NipSnap family of proteins that may be involved in vesicular transport. The encoded protein is localized to mitochondria and plays a role in oxidative phosphorylation. A pseudogene of this gene is located on the long arm of chromosome 2. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110043O21Rik A G 4: 35,193,270 S228P possibly damaging Het
9930021J03Rik C A 19: 29,805,550 A109S probably damaging Het
Adam33 T C 2: 131,053,197 probably benign Het
Ahnak T C 19: 9,010,904 V3184A possibly damaging Het
Aoc1 A G 6: 48,906,150 N320S possibly damaging Het
Bin2 T C 15: 100,645,363 E313G probably damaging Het
Ccdc47 T C 11: 106,205,439 D253G possibly damaging Het
Ccdc73 A G 2: 104,992,039 T778A probably benign Het
Cops3 C A 11: 59,820,013 D377Y probably damaging Het
Cyp4a14 A C 4: 115,493,609 V156G probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Disp1 C A 1: 183,089,499 M452I probably damaging Het
Fam210b T C 2: 172,351,548 Y94H probably damaging Het
Fbxo45 C A 16: 32,246,706 probably benign Het
Flrt2 T A 12: 95,779,203 M105K possibly damaging Het
Gm26558 G A 2: 70,661,312 probably benign Het
Gpr83 T G 9: 14,860,805 L91R probably damaging Het
Greb1l TTTAATAACTT TTT 18: 10,555,950 probably null Het
Hmces T A 6: 87,933,235 probably null Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Ksr2 A C 5: 117,555,009 E174A probably damaging Het
Lats1 A G 10: 7,712,651 T1011A probably benign Het
Lrrc46 T C 11: 97,036,131 D120G probably damaging Het
Ncstn C A 1: 172,067,584 probably benign Het
Neb T C 2: 52,169,118 T6118A probably benign Het
Nlgn2 C T 11: 69,825,390 R775H probably damaging Het
Olfr1284 T A 2: 111,379,253 D84E probably damaging Het
Olfr1309 T A 2: 111,984,021 T18S probably benign Het
Olfr1314 T A 2: 112,092,535 L55F possibly damaging Het
Olfr135 A C 17: 38,208,317 E24A possibly damaging Het
Olfr1474 A T 19: 13,471,430 Q153H probably benign Het
Olfr157 A G 4: 43,836,301 L63P probably damaging Het
Pold1 A G 7: 44,535,832 V750A possibly damaging Het
Prdm11 C T 2: 92,975,472 E378K probably damaging Het
Ptpn9 A G 9: 57,036,670 D276G probably benign Het
Rlf A T 4: 121,148,172 F1204I probably damaging Het
Robo1 C A 16: 72,972,304 T537K possibly damaging Het
Sec31b T A 19: 44,520,531 M670L probably benign Het
Sephs1 T A 2: 4,899,510 V233E possibly damaging Het
Serpinb2 T C 1: 107,523,209 probably null Het
Sf3b3 T C 8: 110,823,376 Q670R possibly damaging Het
Slc8a2 A C 7: 16,145,176 D529A possibly damaging Het
Sva A G 6: 42,042,159 N88D probably benign Het
Tcf15 G T 2: 152,144,131 R169L probably damaging Het
Tfr2 A G 5: 137,574,490 T188A probably benign Het
Tshz1 T A 18: 84,013,215 K1023* probably null Het
Ttc28 A G 5: 111,225,689 N966S probably damaging Het
Unc5c T A 3: 141,757,793 I225N probably damaging Het
Ush2a T C 1: 188,451,870 L1457S possibly damaging Het
Zbtb34 G T 2: 33,411,121 H469Q probably damaging Het
Zfp692 T C 11: 58,307,587 M1T probably null Het
Other mutations in Nipsnap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Nipsnap2 APN 5 129754851 missense probably damaging 0.99
IGL01012:Nipsnap2 APN 5 129746439 missense possibly damaging 0.91
IGL01320:Nipsnap2 APN 5 129744764 missense probably damaging 1.00
IGL01321:Nipsnap2 APN 5 129757141 makesense probably null
IGL02119:Nipsnap2 APN 5 129747992 splice site probably benign
IGL02636:Nipsnap2 APN 5 129745290 intron probably benign
R0540:Nipsnap2 UTSW 5 129754845 missense probably damaging 1.00
R1497:Nipsnap2 UTSW 5 129753218 intron probably benign
R1649:Nipsnap2 UTSW 5 129753237 missense probably damaging 0.99
R1743:Nipsnap2 UTSW 5 129757085 missense probably damaging 1.00
R2020:Nipsnap2 UTSW 5 129753223 splice site probably null
R2187:Nipsnap2 UTSW 5 129746473 splice site probably null
R2215:Nipsnap2 UTSW 5 129739585 missense probably damaging 1.00
R2430:Nipsnap2 UTSW 5 129744791 missense possibly damaging 0.94
R3124:Nipsnap2 UTSW 5 129748034 critical splice donor site probably null
R5072:Nipsnap2 UTSW 5 129739580 missense probably damaging 1.00
R5823:Nipsnap2 UTSW 5 129739769 splice site probably null
R6736:Nipsnap2 UTSW 5 129745288 critical splice donor site probably null
R6913:Nipsnap2 UTSW 5 129753293 missense probably benign 0.11
R7163:Nipsnap2 UTSW 5 129744710 missense probably benign 0.00
R7597:Nipsnap2 UTSW 5 129739573 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTAACATCCTTGTTGATGGAG -3'
(R):5'- CCGCTTCTGGTAGTTCAACC -3'

Sequencing Primer
(F):5'- AACATCCTTGTTGATGGAGTTGGG -3'
(R):5'- TGGTAGTTCAACCCTCCTGAG -3'
Posted On2016-06-21