Mutagenetix > Incidental Mutation

Incidental Mutation 'R5150:Lats1'

395309

Institutional Source

Beutler Lab

Gene Symbol

Lats1

Ensembl Gene

ENSMUSG00000040021

Gene Name

large tumor suppressor

Synonyms

Accession Numbers

Essential gene?

Probably essential (E-score: 0.890) question?

Stock #

R5150 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

7681214-7716460 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 7712651 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1011 (T1011A)

Ref Sequence

ENSEMBL: ENSMUSP00000151533 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040043] [ENSMUST00000165952] [ENSMUST00000217931]

AlphaFold

Q8BYR2

Predicted Effect

probably benign
Transcript: ENSMUST00000040043
AA Change: T1011A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000041915
Gene: ENSMUSG00000040021
AA Change: T1011A

Domain	Start	End	E-Value	Type
Pfam:UBA	101	138	7.4e-11	PFAM
low complexity region	228	267	N/A	INTRINSIC
low complexity region	301	314	N/A	INTRINSIC
low complexity region	371	379	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	482	493	N/A	INTRINSIC
low complexity region	520	530	N/A	INTRINSIC
low complexity region	554	559	N/A	INTRINSIC
S_TKc	704	1009	7.3e-99	SMART
S_TK_X	1010	1081	1.2e-2	SMART
low complexity region	1102	1120	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000165952
AA Change: T1011A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000132078
Gene: ENSMUSG00000040021
AA Change: T1011A

Domain	Start	End	E-Value	Type
Pfam:UBA	101	138	7.4e-11	PFAM
low complexity region	228	267	N/A	INTRINSIC
low complexity region	301	314	N/A	INTRINSIC
low complexity region	371	379	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	482	493	N/A	INTRINSIC
low complexity region	520	530	N/A	INTRINSIC
low complexity region	554	559	N/A	INTRINSIC
S_TKc	704	1009	7.3e-99	SMART
S_TK_X	1010	1081	1.2e-2	SMART
low complexity region	1102	1120	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000217931
AA Change: T1011A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Meta Mutation Damage Score

0.0608

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 93.9%

Validation Efficiency

93% (57/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a putative serine/threonine kinase that localizes to the mitotic apparatus and complexes with cell cycle controller CDC2 kinase in early mitosis. The protein is phosphorylated in a cell-cycle dependent manner, with late prophase phosphorylation remaining through metaphase. The N-terminal region of the protein binds CDC2 to form a complex showing reduced H1 histone kinase activity, indicating a role as a negative regulator of CDC2/cyclin A. In addition, the C-terminal kinase domain binds to its own N-terminal region, suggesting potential negative regulation through interference with complex formation via intramolecular binding. Biochemical and genetic data suggest a role as a tumor suppressor. This is supported by studies in knockout mice showing development of soft-tissue sarcomas, ovarian stromal cell tumors and a high sensitivity to carcinogenic treatments. Two protein-coding transcripts and one non-protein coding transcript have been found for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit high postnatal mortality, lack of mammary development, infertility, pituitary hyperplasia, reduced hormone levels, growth retardation, and susceptibility to sarcomas and ovarian stromal cell tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110043O21Rik	A	G	4: 35,193,270	S228P	possibly damaging	Het
9930021J03Rik	C	A	19: 29,805,550	A109S	probably damaging	Het
Adam33	T	C	2: 131,053,197		probably benign	Het
Ahnak	T	C	19: 9,010,904	V3184A	possibly damaging	Het
Aoc1	A	G	6: 48,906,150	N320S	possibly damaging	Het
Bin2	T	C	15: 100,645,363	E313G	probably damaging	Het
Ccdc47	T	C	11: 106,205,439	D253G	possibly damaging	Het
Ccdc73	A	G	2: 104,992,039	T778A	probably benign	Het
Cops3	C	A	11: 59,820,013	D377Y	probably damaging	Het
Cyp4a14	A	C	4: 115,493,609	V156G	probably damaging	Het
D6Ertd527e	C	G	6: 87,111,524	T223S	unknown	Het
Disp1	C	A	1: 183,089,499	M452I	probably damaging	Het
Fam210b	T	C	2: 172,351,548	Y94H	probably damaging	Het
Fbxo45	C	A	16: 32,246,706		probably benign	Het
Flrt2	T	A	12: 95,779,203	M105K	possibly damaging	Het
Gm26558	G	A	2: 70,661,312		probably benign	Het
Gpr83	T	G	9: 14,860,805	L91R	probably damaging	Het
Greb1l	TTTAATAACTT	TTT	18: 10,555,950		probably null	Het
Hmces	T	A	6: 87,933,235		probably null	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Ksr2	A	C	5: 117,555,009	E174A	probably damaging	Het
Lrrc46	T	C	11: 97,036,131	D120G	probably damaging	Het
Ncstn	C	A	1: 172,067,584		probably benign	Het
Neb	T	C	2: 52,169,118	T6118A	probably benign	Het
Nipsnap2	A	C	5: 129,757,111	M272L	probably benign	Het
Nlgn2	C	T	11: 69,825,390	R775H	probably damaging	Het
Olfr1284	T	A	2: 111,379,253	D84E	probably damaging	Het
Olfr1309	T	A	2: 111,984,021	T18S	probably benign	Het
Olfr1314	T	A	2: 112,092,535	L55F	possibly damaging	Het
Olfr135	A	C	17: 38,208,317	E24A	possibly damaging	Het
Olfr1474	A	T	19: 13,471,430	Q153H	probably benign	Het
Olfr157	A	G	4: 43,836,301	L63P	probably damaging	Het
Pold1	A	G	7: 44,535,832	V750A	possibly damaging	Het
Prdm11	C	T	2: 92,975,472	E378K	probably damaging	Het
Ptpn9	A	G	9: 57,036,670	D276G	probably benign	Het
Rlf	A	T	4: 121,148,172	F1204I	probably damaging	Het
Robo1	C	A	16: 72,972,304	T537K	possibly damaging	Het
Sec31b	T	A	19: 44,520,531	M670L	probably benign	Het
Sephs1	T	A	2: 4,899,510	V233E	possibly damaging	Het
Serpinb2	T	C	1: 107,523,209		probably null	Het
Sf3b3	T	C	8: 110,823,376	Q670R	possibly damaging	Het
Slc8a2	A	C	7: 16,145,176	D529A	possibly damaging	Het
Sva	A	G	6: 42,042,159	N88D	probably benign	Het
Tcf15	G	T	2: 152,144,131	R169L	probably damaging	Het
Tfr2	A	G	5: 137,574,490	T188A	probably benign	Het
Tshz1	T	A	18: 84,013,215	K1023*	probably null	Het
Ttc28	A	G	5: 111,225,689	N966S	probably damaging	Het
Unc5c	T	A	3: 141,757,793	I225N	probably damaging	Het
Ush2a	T	C	1: 188,451,870	L1457S	possibly damaging	Het
Zbtb34	G	T	2: 33,411,121	H469Q	probably damaging	Het
Zfp692	T	C	11: 58,307,587	M1T	probably null	Het

Other mutations in Lats1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00234:Lats1	APN	10	7691566	missense	probably damaging	0.99
IGL00595:Lats1	APN	10	7702305	missense	probably benign	0.00
IGL00932:Lats1	APN	10	7712742	missense	possibly damaging	0.69
IGL01019:Lats1	APN	10	7705671	missense	probably damaging	1.00
IGL01380:Lats1	APN	10	7691780	missense	possibly damaging	0.69
IGL01965:Lats1	APN	10	7701706	missense	probably benign	0.10
IGL02027:Lats1	APN	10	7712948	missense	probably benign
IGL02611:Lats1	APN	10	7705787	missense	possibly damaging	0.91
IGL02997:Lats1	APN	10	7702254	missense	possibly damaging	0.53
IGL03107:Lats1	APN	10	7712746	missense	probably benign	0.15
I1329:Lats1	UTSW	10	7712802	missense	probably benign	0.10
PIT4378001:Lats1	UTSW	10	7705605	missense	probably damaging	1.00
R0153:Lats1	UTSW	10	7691575	missense	probably damaging	1.00
R0568:Lats1	UTSW	10	7712528	missense	possibly damaging	0.69
R0581:Lats1	UTSW	10	7702941	missense	possibly damaging	0.67
R0604:Lats1	UTSW	10	7712661	missense	probably damaging	0.96
R1681:Lats1	UTSW	10	7705914	missense	probably damaging	0.99
R1694:Lats1	UTSW	10	7701945	missense	probably benign	0.07
R1840:Lats1	UTSW	10	7710939	nonsense	probably null
R1914:Lats1	UTSW	10	7710457	splice site	probably benign
R2137:Lats1	UTSW	10	7701847	missense	possibly damaging	0.71
R2317:Lats1	UTSW	10	7691776	nonsense	probably null
R3863:Lats1	UTSW	10	7705746	missense	probably damaging	1.00
R3864:Lats1	UTSW	10	7705746	missense	probably damaging	1.00
R4597:Lats1	UTSW	10	7691746	missense	probably benign	0.00
R4657:Lats1	UTSW	10	7705684	missense	possibly damaging	0.82
R4658:Lats1	UTSW	10	7702729	missense	probably benign
R4663:Lats1	UTSW	10	7712583	missense	probably damaging	1.00
R4870:Lats1	UTSW	10	7705785	missense	probably damaging	1.00
R5101:Lats1	UTSW	10	7712584	nonsense	probably null
R5134:Lats1	UTSW	10	7691811	missense	probably benign	0.34
R5546:Lats1	UTSW	10	7705754	missense	probably damaging	0.99
R5820:Lats1	UTSW	10	7705908	missense	probably damaging	1.00
R6006:Lats1	UTSW	10	7705595	missense	probably damaging	1.00
R6301:Lats1	UTSW	10	7703107	missense	probably benign	0.01
R6544:Lats1	UTSW	10	7701670	missense	possibly damaging	0.94
R6647:Lats1	UTSW	10	7697507	missense	possibly damaging	0.81
R6874:Lats1	UTSW	10	7710851	missense	probably damaging	1.00
R7328:Lats1	UTSW	10	7705547	missense	possibly damaging	0.62
R7390:Lats1	UTSW	10	7702095	nonsense	probably null
R7438:Lats1	UTSW	10	7712942	nonsense	probably null
R7457:Lats1	UTSW	10	7710891	missense	probably damaging	1.00
R7524:Lats1	UTSW	10	7701978	missense	possibly damaging	0.89
R7593:Lats1	UTSW	10	7701712	missense	probably damaging	1.00
R7736:Lats1	UTSW	10	7702364	missense	probably damaging	1.00
R7884:Lats1	UTSW	10	7697526	nonsense	probably null
R8166:Lats1	UTSW	10	7702116	missense	probably benign
R8248:Lats1	UTSW	10	7705903	missense	probably damaging	1.00
R8458:Lats1	UTSW	10	7710924	nonsense	probably null
R8477:Lats1	UTSW	10	7705515	missense	probably damaging	1.00
R8547:Lats1	UTSW	10	7712849	missense	probably damaging	1.00
R9163:Lats1	UTSW	10	7702288	missense	probably benign
R9441:Lats1	UTSW	10	7702917	missense	probably damaging	0.96
R9673:Lats1	UTSW	10	7712623	missense	probably benign	0.29
RF021:Lats1	UTSW	10	7710608	missense	probably damaging	1.00
X0026:Lats1	UTSW	10	7710623	missense	probably damaging	1.00
X0053:Lats1	UTSW	10	7691609	missense	probably benign	0.00
Z1176:Lats1	UTSW	10	7705809	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTACAAAACCTGGGAAATTACTGTG -3'
(R):5'- GAACTCATAGAAAGCGTGCTCG -3'

Sequencing Primer
(F):5'- CCTGGGAAATTACTGTGTTTTATCTC -3'
(R):5'- AAAGCGTGCTCGGGGTG -3'

Posted On

2016-06-21