Mutagenetix > Incidental Mutation

Incidental Mutation 'R5150:Greb1l'

395322

Institutional Source

Beutler Lab

Gene Symbol

Greb1l

Ensembl Gene

ENSMUSG00000042942

Gene Name

growth regulation by estrogen in breast cancer-like

Synonyms

AK220484, mKIAA4095

Accession Numbers

Genbank: NM_001083628; MGI: 3576497

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5150 (G1)

Quality Score

217

Status

Validated

Chromosome

Chromosomal Location

10325177-10562934 bp(+) (GRCm38)

Type of Mutation

frame shift

DNA Base Change (assembly)

TTTAATAACTT to TTT at 10555950 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000049003 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048977]

AlphaFold

B9EJV3

Predicted Effect

probably null
Transcript: ENSMUST00000048977

SMART Domains

Protein: ENSMUSP00000049003
Gene: ENSMUSG00000042942

Domain	Start	End	E-Value	Type
Pfam:GREB1	1	1172	N/A	PFAM
Pfam:GREB1	1154	1913	N/A	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122744

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173261

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 93.9%

Validation Efficiency

93% (57/61)

Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110043O21Rik	A	G	4: 35,193,270	S228P	possibly damaging	Het
9930021J03Rik	C	A	19: 29,805,550	A109S	probably damaging	Het
Adam33	T	C	2: 131,053,197		probably benign	Het
Ahnak	T	C	19: 9,010,904	V3184A	possibly damaging	Het
Aoc1	A	G	6: 48,906,150	N320S	possibly damaging	Het
Bin2	T	C	15: 100,645,363	E313G	probably damaging	Het
Ccdc47	T	C	11: 106,205,439	D253G	possibly damaging	Het
Ccdc73	A	G	2: 104,992,039	T778A	probably benign	Het
Cops3	C	A	11: 59,820,013	D377Y	probably damaging	Het
Cyp4a14	A	C	4: 115,493,609	V156G	probably damaging	Het
D6Ertd527e	C	G	6: 87,111,524	T223S	unknown	Het
Disp1	C	A	1: 183,089,499	M452I	probably damaging	Het
Fam210b	T	C	2: 172,351,548	Y94H	probably damaging	Het
Fbxo45	C	A	16: 32,246,706		probably benign	Het
Flrt2	T	A	12: 95,779,203	M105K	possibly damaging	Het
Gm26558	G	A	2: 70,661,312		probably benign	Het
Gpr83	T	G	9: 14,860,805	L91R	probably damaging	Het
Hmces	T	A	6: 87,933,235		probably null	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Ksr2	A	C	5: 117,555,009	E174A	probably damaging	Het
Lats1	A	G	10: 7,712,651	T1011A	probably benign	Het
Lrrc46	T	C	11: 97,036,131	D120G	probably damaging	Het
Ncstn	C	A	1: 172,067,584		probably benign	Het
Neb	T	C	2: 52,169,118	T6118A	probably benign	Het
Nipsnap2	A	C	5: 129,757,111	M272L	probably benign	Het
Nlgn2	C	T	11: 69,825,390	R775H	probably damaging	Het
Olfr1284	T	A	2: 111,379,253	D84E	probably damaging	Het
Olfr1309	T	A	2: 111,984,021	T18S	probably benign	Het
Olfr1314	T	A	2: 112,092,535	L55F	possibly damaging	Het
Olfr135	A	C	17: 38,208,317	E24A	possibly damaging	Het
Olfr1474	A	T	19: 13,471,430	Q153H	probably benign	Het
Olfr157	A	G	4: 43,836,301	L63P	probably damaging	Het
Pold1	A	G	7: 44,535,832	V750A	possibly damaging	Het
Prdm11	C	T	2: 92,975,472	E378K	probably damaging	Het
Ptpn9	A	G	9: 57,036,670	D276G	probably benign	Het
Rlf	A	T	4: 121,148,172	F1204I	probably damaging	Het
Robo1	C	A	16: 72,972,304	T537K	possibly damaging	Het
Sec31b	T	A	19: 44,520,531	M670L	probably benign	Het
Sephs1	T	A	2: 4,899,510	V233E	possibly damaging	Het
Serpinb2	T	C	1: 107,523,209		probably null	Het
Sf3b3	T	C	8: 110,823,376	Q670R	possibly damaging	Het
Slc8a2	A	C	7: 16,145,176	D529A	possibly damaging	Het
Sva	A	G	6: 42,042,159	N88D	probably benign	Het
Tcf15	G	T	2: 152,144,131	R169L	probably damaging	Het
Tfr2	A	G	5: 137,574,490	T188A	probably benign	Het
Tshz1	T	A	18: 84,013,215	K1023*	probably null	Het
Ttc28	A	G	5: 111,225,689	N966S	probably damaging	Het
Unc5c	T	A	3: 141,757,793	I225N	probably damaging	Het
Ush2a	T	C	1: 188,451,870	L1457S	possibly damaging	Het
Zbtb34	G	T	2: 33,411,121	H469Q	probably damaging	Het
Zfp692	T	C	11: 58,307,587	M1T	probably null	Het

Other mutations in Greb1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00485:Greb1l	APN	18	10555962	missense	possibly damaging	0.90
IGL01554:Greb1l	APN	18	10522144	missense	probably benign	0.01
IGL01563:Greb1l	APN	18	10469399	missense	probably damaging	0.99
IGL01944:Greb1l	APN	18	10557280	missense	possibly damaging	0.91
IGL02110:Greb1l	APN	18	10515271	missense	probably damaging	1.00
IGL02249:Greb1l	APN	18	10532961	missense	probably damaging	1.00
IGL02318:Greb1l	APN	18	10469388	missense	possibly damaging	0.91
IGL02340:Greb1l	APN	18	10515200	missense	probably damaging	0.99
IGL02516:Greb1l	APN	18	10537064	missense	probably benign	0.31
IGL02566:Greb1l	APN	18	10503299	missense	probably damaging	0.99
IGL02583:Greb1l	APN	18	10542362	missense	probably damaging	1.00
IGL02838:Greb1l	APN	18	10560430	missense	probably damaging	1.00
A4554:Greb1l	UTSW	18	10532862	missense	possibly damaging	0.58
PIT4453001:Greb1l	UTSW	18	10533031	missense	probably damaging	0.98
PIT4453001:Greb1l	UTSW	18	10533032	missense	probably benign	0.08
R0099:Greb1l	UTSW	18	10509158	missense	probably damaging	1.00
R0226:Greb1l	UTSW	18	10522076	intron	probably benign
R0234:Greb1l	UTSW	18	10560331	missense	probably damaging	1.00
R0234:Greb1l	UTSW	18	10560331	missense	probably damaging	1.00
R0239:Greb1l	UTSW	18	10458567	splice site	probably benign
R0316:Greb1l	UTSW	18	10547420	missense	probably damaging	1.00
R0369:Greb1l	UTSW	18	10469375	missense	possibly damaging	0.80
R0394:Greb1l	UTSW	18	10523374	missense	probably damaging	0.99
R0478:Greb1l	UTSW	18	10509281	missense	probably damaging	1.00
R0555:Greb1l	UTSW	18	10458781	splice site	probably benign
R0671:Greb1l	UTSW	18	10474303	missense	probably damaging	1.00
R1282:Greb1l	UTSW	18	10547289	missense	probably benign	0.13
R1574:Greb1l	UTSW	18	10554997	missense	possibly damaging	0.95
R1574:Greb1l	UTSW	18	10554997	missense	possibly damaging	0.95
R1607:Greb1l	UTSW	18	10529703	missense	possibly damaging	0.85
R1666:Greb1l	UTSW	18	10501080	critical splice donor site	probably null
R1666:Greb1l	UTSW	18	10529708	critical splice donor site	probably null
R1720:Greb1l	UTSW	18	10553848	missense	probably benign	0.19
R1808:Greb1l	UTSW	18	10542143	missense	probably benign
R1829:Greb1l	UTSW	18	10509314	missense	probably damaging	1.00
R1897:Greb1l	UTSW	18	10498992	missense	probably benign	0.00
R1967:Greb1l	UTSW	18	10501049	missense	possibly damaging	0.91
R2025:Greb1l	UTSW	18	10515221	missense	possibly damaging	0.71
R2086:Greb1l	UTSW	18	10523281	missense	probably damaging	1.00
R2125:Greb1l	UTSW	18	10511422	missense	probably damaging	0.98
R2139:Greb1l	UTSW	18	10555011	missense	probably damaging	1.00
R2255:Greb1l	UTSW	18	10554857	missense	probably damaging	1.00
R2256:Greb1l	UTSW	18	10503307	missense	possibly damaging	0.91
R2257:Greb1l	UTSW	18	10503307	missense	possibly damaging	0.91
R2880:Greb1l	UTSW	18	10547288	missense	possibly damaging	0.93
R3623:Greb1l	UTSW	18	10542380	missense	probably damaging	0.99
R3778:Greb1l	UTSW	18	10469444	missense	possibly damaging	0.60
R3975:Greb1l	UTSW	18	10522247	missense	possibly damaging	0.71
R4038:Greb1l	UTSW	18	10515209	missense	possibly damaging	0.93
R4062:Greb1l	UTSW	18	10522150	missense	probably damaging	0.99
R4134:Greb1l	UTSW	18	10529708	critical splice donor site	probably null
R4342:Greb1l	UTSW	18	10544561	missense	probably benign	0.12
R4409:Greb1l	UTSW	18	10503182	missense	possibly damaging	0.70
R4600:Greb1l	UTSW	18	10553705	missense	probably damaging	1.00
R4618:Greb1l	UTSW	18	10498965	missense	probably benign	0.00
R4683:Greb1l	UTSW	18	10529563	splice site	probably null
R4686:Greb1l	UTSW	18	10522112	missense	probably damaging	0.98
R4707:Greb1l	UTSW	18	10532922	missense	probably benign	0.02
R4780:Greb1l	UTSW	18	10541792	missense	probably benign	0.00
R4819:Greb1l	UTSW	18	10458358	missense	probably damaging	1.00
R4925:Greb1l	UTSW	18	10547447	missense	possibly damaging	0.79
R4960:Greb1l	UTSW	18	10547306	missense	probably damaging	0.99
R5154:Greb1l	UTSW	18	10458312	missense	probably benign	0.02
R5269:Greb1l	UTSW	18	10511409	missense	probably benign
R5290:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5310:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5328:Greb1l	UTSW	18	10553720	missense	probably damaging	1.00
R5337:Greb1l	UTSW	18	10509143	missense	probably damaging	1.00
R5393:Greb1l	UTSW	18	10458312	missense	probably benign	0.02
R5402:Greb1l	UTSW	18	10537169	missense	probably benign	0.26
R5718:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5719:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5720:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5721:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5902:Greb1l	UTSW	18	10538302	missense	probably benign	0.00
R5993:Greb1l	UTSW	18	10544455	missense	probably benign	0.10
R6035:Greb1l	UTSW	18	10501025	missense	possibly damaging	0.91
R6035:Greb1l	UTSW	18	10501025	missense	possibly damaging	0.91
R6045:Greb1l	UTSW	18	10547068	missense	probably damaging	1.00
R6063:Greb1l	UTSW	18	10557340	missense	probably damaging	1.00
R6297:Greb1l	UTSW	18	10469494	missense	probably damaging	1.00
R6405:Greb1l	UTSW	18	10501076	missense	probably benign	0.30
R6552:Greb1l	UTSW	18	10541814	missense	probably benign	0.00
R6572:Greb1l	UTSW	18	10522131	missense	probably benign	0.07
R6575:Greb1l	UTSW	18	10547347	missense	possibly damaging	0.88
R6922:Greb1l	UTSW	18	10547482	missense	possibly damaging	0.88
R6957:Greb1l	UTSW	18	10558786	missense	probably benign	0.23
R6962:Greb1l	UTSW	18	10547327	missense	probably damaging	1.00
R7012:Greb1l	UTSW	18	10529707	critical splice donor site	probably null
R7179:Greb1l	UTSW	18	10544576	missense	probably benign	0.00
R7251:Greb1l	UTSW	18	10515319	missense	probably damaging	1.00
R7275:Greb1l	UTSW	18	10544561	missense	probably benign	0.12
R7301:Greb1l	UTSW	18	10544970	missense	probably damaging	1.00
R7307:Greb1l	UTSW	18	10538142	missense	probably damaging	0.99
R7455:Greb1l	UTSW	18	10554915	missense	probably damaging	1.00
R7832:Greb1l	UTSW	18	10542056	missense	probably benign	0.38
R7934:Greb1l	UTSW	18	10474371	nonsense	probably null
R8137:Greb1l	UTSW	18	10474357	missense	possibly damaging	0.77
R8138:Greb1l	UTSW	18	10533060	missense	probably benign	0.13
R8208:Greb1l	UTSW	18	10510703	missense	probably damaging	1.00
R8227:Greb1l	UTSW	18	10515371	missense	probably damaging	1.00
R8312:Greb1l	UTSW	18	10511587	intron	probably benign
R8331:Greb1l	UTSW	18	10458706	missense	possibly damaging	0.96
R8364:Greb1l	UTSW	18	10529687	missense	possibly damaging	0.85
R8389:Greb1l	UTSW	18	10529613	missense	probably benign	0.00
R8695:Greb1l	UTSW	18	10544450	missense	probably benign	0.01
R8795:Greb1l	UTSW	18	10553739	missense	probably damaging	0.98
R8836:Greb1l	UTSW	18	10509257	missense	probably benign	0.30
R8862:Greb1l	UTSW	18	10555042	missense	possibly damaging	0.90
R8872:Greb1l	UTSW	18	10529684	missense	probably benign	0.18
R8874:Greb1l	UTSW	18	10544896	missense	probably benign	0.01
R8886:Greb1l	UTSW	18	10553843	missense	probably benign	0.21
R8921:Greb1l	UTSW	18	10541825	missense	probably benign	0.01
R8997:Greb1l	UTSW	18	10510747	missense	probably damaging	1.00
R9015:Greb1l	UTSW	18	10541675	missense	probably benign	0.00
R9018:Greb1l	UTSW	18	10542004	missense	possibly damaging	0.76
R9074:Greb1l	UTSW	18	10532797	missense	probably damaging	1.00
R9074:Greb1l	UTSW	18	10558795	missense	probably damaging	1.00
R9117:Greb1l	UTSW	18	10542422	missense	probably benign	0.31
R9189:Greb1l	UTSW	18	10499983	missense	probably benign
R9332:Greb1l	UTSW	18	10532796	missense	possibly damaging	0.92
R9367:Greb1l	UTSW	18	10522130	missense	probably benign	0.00
R9497:Greb1l	UTSW	18	10458600	missense	probably benign	0.00
Z1176:Greb1l	UTSW	18	10515305	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGGCCAACTTCCTGAGGATAAG -3'
(R):5'- ACAAATGAAGCTGCACATGG -3'

Sequencing Primer
(F):5'- CATAGTTGAGATGTGGCAG -3'
(R):5'- AAGCTGCACATGGAGGCC -3'

Posted On

2016-06-21