Mutagenetix > Incidental Mutation

Incidental Mutation 'R5151:Plcb1'

395340

Institutional Source

Beutler Lab

Gene Symbol

Plcb1

Ensembl Gene

ENSMUSG00000051177

Gene Name

phospholipase C, beta 1

Synonyms

3110043I21Rik

MMRRC Submission

042733-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.201) question?

Stock #

R5151 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

134786067-135475258 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 135262245 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 278 (Y278F)

Ref Sequence

ENSEMBL: ENSMUSP00000118756 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070724] [ENSMUST00000110116] [ENSMUST00000131552]

AlphaFold

Q9Z1B3

Predicted Effect

probably benign
Transcript: ENSMUST00000070724
AA Change: Y278F

PolyPhen 2 Score 0.279 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000064844
Gene: ENSMUSG00000051177
AA Change: Y278F

Domain	Start	End	E-Value	Type
Pfam:EF-hand_like	224	315	2.2e-26	PFAM
PLCXc	316	467	2.85e-74	SMART
low complexity region	491	501	N/A	INTRINSIC
PLCYc	540	656	2e-69	SMART
C2	677	776	1.55e-12	SMART
low complexity region	871	885	N/A	INTRINSIC
Pfam:DUF1154	903	946	1.3e-7	PFAM
low complexity region	967	984	N/A	INTRINSIC
Pfam:PLC-beta_C	997	1155	1.9e-64	PFAM
low complexity region	1157	1168	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110116
AA Change: Y278F

PolyPhen 2 Score 0.279 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000105743
Gene: ENSMUSG00000051177
AA Change: Y278F

Domain	Start	End	E-Value	Type
Pfam:EF-hand_like	224	315	4.1e-26	PFAM
PLCXc	316	467	2.85e-74	SMART
low complexity region	491	501	N/A	INTRINSIC
PLCYc	540	656	2e-69	SMART
C2	677	776	1.55e-12	SMART
low complexity region	871	885	N/A	INTRINSIC
Pfam:DUF1154	903	946	1.1e-9	PFAM
low complexity region	967	984	N/A	INTRINSIC
Pfam:PLC-beta_C	1003	1176	2.9e-61	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129382

Predicted Effect

probably benign
Transcript: ENSMUST00000131552
AA Change: Y278F

PolyPhen 2 Score 0.279 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000118756
Gene: ENSMUSG00000051177
AA Change: Y278F

Domain	Start	End	E-Value	Type
Pfam:EF-hand_like	224	315	3.9e-26	PFAM
PLCXc	316	467	2.85e-74	SMART
low complexity region	491	501	N/A	INTRINSIC
PLCYc	540	656	2e-69	SMART
C2	677	776	1.55e-12	SMART
low complexity region	871	885	N/A	INTRINSIC
Pfam:DUF1154	903	946	1e-9	PFAM
low complexity region	967	984	N/A	INTRINSIC
Pfam:PLC-beta_C	1003	1148	8e-51	PFAM
low complexity region	1157	1168	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000201485

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the formation of inositol 1,4,5-trisphosphate and diacylglycerol from phosphatidylinositol 4,5-bisphosphate. This reaction uses calcium as a cofactor and plays an important role in the intracellular transduction of many extracellular signals. This gene is activated by two G-protein alpha subunits, alpha-q and alpha-11. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit spontaneous seizures and high mortality around 3 weeks of age. Mutant males show exhibit sperm with a reduced acrosome reaction rate and fertilizing capacity in vitro and decreased fertility in vivo. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acvr1b	T	A	15: 101,210,770	C476S	probably damaging	Het
Agpat2	A	G	2: 26,597,206	M120T	probably damaging	Het
Ahnak	A	G	19: 9,017,569	T5406A	probably benign	Het
Ano4	A	G	10: 89,112,913	F112L	probably damaging	Het
Arhgef11	T	A	3: 87,735,360	V1371D	probably damaging	Het
Ascc3	A	G	10: 50,637,963	N286S	probably damaging	Het
Ate1	T	C	7: 130,507,664	K202E	possibly damaging	Het
Cacna1d	T	C	14: 30,123,323	T630A	probably damaging	Het
Ccdc187	G	T	2: 26,293,439	T183N	probably damaging	Het
Cdk12	C	T	11: 98,249,923		probably benign	Het
Ciita	A	G	16: 10,523,730	N978S	probably damaging	Het
Cit	A	T	5: 115,979,835	Q1268L	probably damaging	Het
Csf2rb	C	T	15: 78,340,581	R180W	probably damaging	Het
Dnah17	T	C	11: 118,027,467	I4079V	probably damaging	Het
Dnah7a	A	G	1: 53,620,770	V693A	probably benign	Het
Dnah8	T	A	17: 30,712,295	V1428E	probably benign	Het
Dnhd1	C	A	7: 105,713,440	Q3777K	probably benign	Het
Dock9	A	G	14: 121,578,170	Y1666H	probably damaging	Het
Dpysl3	C	T	18: 43,438,080	G43D	probably benign	Het
Eftud2	A	G	11: 102,867,844		probably null	Het
Erich4	T	C	7: 25,615,867		probably benign	Het
Fah	T	A	7: 84,601,051	D99V	possibly damaging	Het
Fat1	T	C	8: 44,951,814	V534A	possibly damaging	Het
Fgf21	G	C	7: 45,614,032	S207R	probably damaging	Het
Fras1	C	T	5: 96,645,110	P967S	probably damaging	Het
H2-T23	T	C	17: 36,032,338	D49G	probably damaging	Het
Hmcn2	A	G	2: 31,389,443	N1819S	probably null	Het
Hoxc12	A	G	15: 102,938,446	I258V	probably damaging	Het
Ighv1-22	T	A	12: 114,746,308	T106S	probably damaging	Het
Inpp5j	T	C	11: 3,502,270	T327A	probably damaging	Het
Iqgap3	G	T	3: 88,117,760	M689I	possibly damaging	Het
Itga7	G	A	10: 128,944,511	G559S	possibly damaging	Het
Kcnq1	G	T	7: 143,426,012	V632L	probably benign	Het
Lsamp	T	C	16: 42,134,429	V230A	probably damaging	Het
Mfn2	A	T	4: 147,886,328	S305T	probably benign	Het
Myom3	A	G	4: 135,789,572	T818A	probably benign	Het
Nacc2	G	A	2: 26,090,353	R24C	probably damaging	Het
Ntrk3	A	C	7: 78,247,300	I663R	probably damaging	Het
Nyap1	A	G	5: 137,736,114	V219A	probably damaging	Het
Obox3	A	T	7: 15,626,248	N165K	probably damaging	Het
Olfr1382	A	G	11: 49,535,415	T77A	possibly damaging	Het
Olfr211	T	A	6: 116,493,804	L65*	probably null	Het
Olfr544	G	A	7: 102,484,985	T45I	probably benign	Het
Olfr589	C	A	7: 103,155,386	M120I	probably damaging	Het
Olfr71	A	T	4: 43,706,518	F17I	probably damaging	Het
Pask	A	T	1: 93,334,628	L170H	probably damaging	Het
Piezo2	A	T	18: 63,030,409	I2146N	possibly damaging	Het
Pitpnm2	A	T	5: 124,136,386	M220K	probably damaging	Het
Pkhd1l1	A	G	15: 44,505,309	D841G	probably benign	Het
Pla2g3	C	T	11: 3,490,827	T264M	probably benign	Het
Prkdc	T	C	16: 15,716,035	L1579P	probably damaging	Het
Rad51ap2	T	A	12: 11,457,515	N479K	probably benign	Het
Rasgrf2	T	C	13: 91,896,036	H966R	probably damaging	Het
Rbm27	A	G	18: 42,338,444	D996G	probably damaging	Het
Rif1	A	C	2: 52,120,309	K2337T	probably damaging	Het
Rpl13a	G	T	7: 45,125,961	N442K	probably benign	Het
Serpini2	T	A	3: 75,246,513	T380S	possibly damaging	Het
Setbp1	A	T	18: 78,857,999	W818R	probably damaging	Het
Siae	T	A	9: 37,631,573	C185S	probably benign	Het
Slc15a2	A	G	16: 36,752,297	V674A	probably damaging	Het
Slc40a1	A	T	1: 45,911,356	M312K	possibly damaging	Het
Slc46a3	A	G	5: 147,886,756	L92S	probably damaging	Het
Son	T	C	16: 91,655,699	S445P	probably damaging	Het
Syne2	T	C	12: 76,043,710	F351L	probably benign	Het
Tmed3	G	A	9: 89,699,772	R213*	probably null	Het
Tmem248	T	A	5: 130,240,397	L277H	probably damaging	Het
Unc13c	T	A	9: 73,931,475	H698L	probably benign	Het
Ushbp1	A	G	8: 71,395,155	V24A	possibly damaging	Het
Usp24	G	T	4: 106,399,112		probably null	Het
Vmn2r50	T	G	7: 10,053,043	I46L	probably benign	Het
Zfp106	T	C	2: 120,534,727	T423A	probably benign	Het
Zfp663	T	A	2: 165,353,193	T369S	probably benign	Het
Zmynd11	T	C	13: 9,690,917	T382A	probably damaging	Het

Other mutations in Plcb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00510:Plcb1	APN	2	135251756	missense	possibly damaging	0.66
IGL01152:Plcb1	APN	2	134813659	missense	probably damaging	1.00
IGL01945:Plcb1	APN	2	135220791	missense	probably benign	0.03
IGL01999:Plcb1	APN	2	135346318	missense	probably damaging	1.00
IGL02109:Plcb1	APN	2	134786559	missense	probably damaging	1.00
IGL02153:Plcb1	APN	2	135387853	missense	probably benign	0.08
IGL02207:Plcb1	APN	2	135387171	missense	probably damaging	1.00
IGL02566:Plcb1	APN	2	135472263	missense	probably benign	0.17
IGL02590:Plcb1	APN	2	135294864	missense	probably benign	0.08
IGL02640:Plcb1	APN	2	135220859	splice site	probably benign
IGL02926:Plcb1	APN	2	135364762	splice site	probably benign
IGL03071:Plcb1	APN	2	135387802	missense	probably damaging	1.00
IGL03236:Plcb1	APN	2	135346306	missense	probably damaging	1.00
IGL03252:Plcb1	APN	2	135370428	missense	probably benign
IGL03387:Plcb1	APN	2	134813686	splice site	probably benign
BB001:Plcb1	UTSW	2	135359693	missense	probably benign	0.00
BB011:Plcb1	UTSW	2	135359693	missense	probably benign	0.00
R0024:Plcb1	UTSW	2	135362425	missense	probably benign	0.06
R0024:Plcb1	UTSW	2	135362425	missense	probably benign	0.06
R0053:Plcb1	UTSW	2	135294915	missense	probably benign	0.33
R0053:Plcb1	UTSW	2	135294915	missense	probably benign	0.33
R0308:Plcb1	UTSW	2	134813614	missense	probably benign	0.01
R0415:Plcb1	UTSW	2	135337499	missense	probably damaging	1.00
R0624:Plcb1	UTSW	2	135294911	missense	possibly damaging	0.81
R0898:Plcb1	UTSW	2	135387143	missense	possibly damaging	0.73
R1071:Plcb1	UTSW	2	135325657	missense	possibly damaging	0.64
R1615:Plcb1	UTSW	2	135362444	splice site	probably benign
R1617:Plcb1	UTSW	2	135337441	missense	probably damaging	1.00
R1785:Plcb1	UTSW	2	135325667	nonsense	probably null
R1866:Plcb1	UTSW	2	135344173	missense	probably benign	0.01
R1869:Plcb1	UTSW	2	135311014	missense	probably benign	0.02
R1902:Plcb1	UTSW	2	134813613	missense	possibly damaging	0.93
R1938:Plcb1	UTSW	2	135386302	missense	probably damaging	1.00
R2016:Plcb1	UTSW	2	135362420	missense	possibly damaging	0.94
R2017:Plcb1	UTSW	2	135362420	missense	possibly damaging	0.94
R2131:Plcb1	UTSW	2	135325667	nonsense	probably null
R2132:Plcb1	UTSW	2	135325667	nonsense	probably null
R2133:Plcb1	UTSW	2	135325667	nonsense	probably null
R2164:Plcb1	UTSW	2	135346330	missense	possibly damaging	0.87
R2419:Plcb1	UTSW	2	135262100	splice site	probably benign
R2429:Plcb1	UTSW	2	135337442	missense	probably damaging	0.99
R2508:Plcb1	UTSW	2	135260508	missense	probably benign	0.27
R3161:Plcb1	UTSW	2	135335482	missense	probably benign	0.03
R3870:Plcb1	UTSW	2	135325671	missense	probably damaging	0.99
R4191:Plcb1	UTSW	2	135345090	missense	probably damaging	1.00
R4239:Plcb1	UTSW	2	135344158	missense	probably damaging	0.99
R4552:Plcb1	UTSW	2	135335493	missense	probably benign	0.44
R4553:Plcb1	UTSW	2	135335493	missense	probably benign	0.44
R4720:Plcb1	UTSW	2	135251747	missense	possibly damaging	0.70
R4946:Plcb1	UTSW	2	135345095	missense	probably benign	0.01
R5012:Plcb1	UTSW	2	135333400	missense	probably null	0.97
R5320:Plcb1	UTSW	2	135252776	missense	possibly damaging	0.56
R5415:Plcb1	UTSW	2	135347402	missense	possibly damaging	0.67
R5523:Plcb1	UTSW	2	135260566	missense	probably benign	0.08
R5568:Plcb1	UTSW	2	135370593	missense	probably damaging	1.00
R5688:Plcb1	UTSW	2	135335480	missense	probably benign	0.06
R5809:Plcb1	UTSW	2	135262244	missense	possibly damaging	0.83
R6237:Plcb1	UTSW	2	135370566	missense	possibly damaging	0.94
R6315:Plcb1	UTSW	2	135346341	missense	probably benign	0.00
R6478:Plcb1	UTSW	2	135335451	missense	probably damaging	1.00
R6531:Plcb1	UTSW	2	135325802	critical splice donor site	probably null
R6683:Plcb1	UTSW	2	134786593	missense	probably benign	0.32
R6760:Plcb1	UTSW	2	135472060	missense	possibly damaging	0.50
R6947:Plcb1	UTSW	2	135386155	missense	probably benign	0.08
R6976:Plcb1	UTSW	2	135262239	missense	possibly damaging	0.75
R7379:Plcb1	UTSW	2	135370510	missense	probably benign	0.45
R7473:Plcb1	UTSW	2	135344276	missense	probably damaging	0.98
R7492:Plcb1	UTSW	2	135251764	nonsense	probably null
R7498:Plcb1	UTSW	2	135262233	nonsense	probably null
R7498:Plcb1	UTSW	2	135262234	missense	probably damaging	0.99
R7777:Plcb1	UTSW	2	135220757	missense	possibly damaging	0.51
R7924:Plcb1	UTSW	2	135359693	missense	probably benign	0.00
R8061:Plcb1	UTSW	2	135346396	missense	probably benign
R8099:Plcb1	UTSW	2	135251734	missense	possibly damaging	0.68
R8299:Plcb1	UTSW	2	135335476	missense	probably damaging	1.00
R8394:Plcb1	UTSW	2	135317790	missense	probably damaging	1.00
R8439:Plcb1	UTSW	2	135250052	critical splice donor site	probably null
R8549:Plcb1	UTSW	2	135364933	missense	probably benign	0.00
R8693:Plcb1	UTSW	2	135252776	missense	probably benign	0.00
R8750:Plcb1	UTSW	2	135335449	missense	probably damaging	1.00
R8817:Plcb1	UTSW	2	135333509	intron	probably benign
R8950:Plcb1	UTSW	2	135337519	missense	probably damaging	1.00
R9146:Plcb1	UTSW	2	135340695	missense	probably damaging	1.00
R9301:Plcb1	UTSW	2	135325690	missense	possibly damaging	0.96
R9311:Plcb1	UTSW	2	135347465	missense	probably benign	0.00
R9459:Plcb1	UTSW	2	135322638	missense	probably benign	0.03
S24628:Plcb1	UTSW	2	135337499	missense	probably damaging	1.00
X0025:Plcb1	UTSW	2	135345054	missense	possibly damaging	0.87
Z1088:Plcb1	UTSW	2	135220846	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- GTGGAACAGACTGTGATTTCTTCTC -3'
(R):5'- AAAACTTTGTGGCTTGCACC -3'

Sequencing Primer
(F):5'- AACAGACTGTGATTTCTTCTCTTTCC -3'
(R):5'- TGGCTTGCACCACAAACAG -3'

Posted On

2016-06-21