Incidental Mutation 'R5151:Arhgef11'
ID395343
Institutional Source Beutler Lab
Gene Symbol Arhgef11
Ensembl Gene ENSMUSG00000041977
Gene NameRho guanine nucleotide exchange factor (GEF) 11
SynonymsPrg, PDZ-RhoGEF
MMRRC Submission 042733-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5151 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location87617559-87738034 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87735360 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 1371 (V1371D)
Ref Sequence ENSEMBL: ENSMUSP00000118123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023846] [ENSMUST00000039476] [ENSMUST00000129113] [ENSMUST00000152006]
Predicted Effect probably benign
Transcript: ENSMUST00000023846
SMART Domains Protein: ENSMUSP00000023846
Gene: ENSMUSG00000023084

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
Blast:LRR 165 191 6e-7 BLAST
LRR 219 246 4.24e-1 SMART
LRR 251 278 1.33e-1 SMART
LRR 279 306 1.98e-4 SMART
low complexity region 312 323 N/A INTRINSIC
low complexity region 329 337 N/A INTRINSIC
low complexity region 376 390 N/A INTRINSIC
low complexity region 407 414 N/A INTRINSIC
LRR 472 499 1.83e2 SMART
low complexity region 547 557 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000039476
AA Change: V1400D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000039900
Gene: ENSMUSG00000041977
AA Change: V1400D

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
PDZ 55 123 2.45e-18 SMART
low complexity region 149 160 N/A INTRINSIC
coiled coil region 205 231 N/A INTRINSIC
RGS 353 472 3.36e-11 SMART
low complexity region 554 565 N/A INTRINSIC
low complexity region 625 639 N/A INTRINSIC
low complexity region 681 694 N/A INTRINSIC
RhoGEF 768 952 1.11e-65 SMART
PH 996 1111 9.49e-6 SMART
low complexity region 1153 1166 N/A INTRINSIC
low complexity region 1176 1188 N/A INTRINSIC
low complexity region 1333 1343 N/A INTRINSIC
low complexity region 1357 1367 N/A INTRINSIC
low complexity region 1478 1490 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000129113
AA Change: V1371D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118123
Gene: ENSMUSG00000041977
AA Change: V1371D

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
PDZ 55 123 2.45e-18 SMART
low complexity region 149 160 N/A INTRINSIC
RGS 313 432 3.36e-11 SMART
low complexity region 596 610 N/A INTRINSIC
low complexity region 652 665 N/A INTRINSIC
RhoGEF 739 923 1.11e-65 SMART
PH 967 1082 9.49e-6 SMART
low complexity region 1124 1137 N/A INTRINSIC
low complexity region 1147 1159 N/A INTRINSIC
low complexity region 1304 1314 N/A INTRINSIC
low complexity region 1328 1338 N/A INTRINSIC
low complexity region 1449 1461 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152006
SMART Domains Protein: ENSMUSP00000122166
Gene: ENSMUSG00000041977

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
PDZ 55 123 2.45e-18 SMART
low complexity region 149 160 N/A INTRINSIC
coiled coil region 205 231 N/A INTRINSIC
RGS 353 472 3.36e-11 SMART
low complexity region 554 565 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172985
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174381
Predicted Effect probably benign
Transcript: ENSMUST00000174581
SMART Domains Protein: ENSMUSP00000134711
Gene: ENSMUSG00000023084

DomainStartEndE-ValueType
Blast:LRR 67 94 1e-10 BLAST
low complexity region 142 152 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. A similar protein in rat interacts with glutamate transporter EAAT4 and modulates its glutamate transport activity. Expression of the rat protein induces the reorganization of the actin cytoskeleton and its overexpression induces the formation of membrane ruffling and filopodia. Two alternative transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no obvious phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1b T A 15: 101,210,770 C476S probably damaging Het
Agpat2 A G 2: 26,597,206 M120T probably damaging Het
Ahnak A G 19: 9,017,569 T5406A probably benign Het
Ano4 A G 10: 89,112,913 F112L probably damaging Het
Ascc3 A G 10: 50,637,963 N286S probably damaging Het
Ate1 T C 7: 130,507,664 K202E possibly damaging Het
Cacna1d T C 14: 30,123,323 T630A probably damaging Het
Ccdc187 G T 2: 26,293,439 T183N probably damaging Het
Cdk12 C T 11: 98,249,923 probably benign Het
Ciita A G 16: 10,523,730 N978S probably damaging Het
Cit A T 5: 115,979,835 Q1268L probably damaging Het
Csf2rb C T 15: 78,340,581 R180W probably damaging Het
Dnah17 T C 11: 118,027,467 I4079V probably damaging Het
Dnah7a A G 1: 53,620,770 V693A probably benign Het
Dnah8 T A 17: 30,712,295 V1428E probably benign Het
Dnhd1 C A 7: 105,713,440 Q3777K probably benign Het
Dock9 A G 14: 121,578,170 Y1666H probably damaging Het
Dpysl3 C T 18: 43,438,080 G43D probably benign Het
Eftud2 A G 11: 102,867,844 probably null Het
Erich4 T C 7: 25,615,867 probably benign Het
Fah T A 7: 84,601,051 D99V possibly damaging Het
Fat1 T C 8: 44,951,814 V534A possibly damaging Het
Fgf21 G C 7: 45,614,032 S207R probably damaging Het
Fras1 C T 5: 96,645,110 P967S probably damaging Het
H2-T23 T C 17: 36,032,338 D49G probably damaging Het
Hmcn2 A G 2: 31,389,443 N1819S probably null Het
Hoxc12 A G 15: 102,938,446 I258V probably damaging Het
Ighv1-22 T A 12: 114,746,308 T106S probably damaging Het
Inpp5j T C 11: 3,502,270 T327A probably damaging Het
Iqgap3 G T 3: 88,117,760 M689I possibly damaging Het
Itga7 G A 10: 128,944,511 G559S possibly damaging Het
Kcnq1 G T 7: 143,426,012 V632L probably benign Het
Lsamp T C 16: 42,134,429 V230A probably damaging Het
Mfn2 A T 4: 147,886,328 S305T probably benign Het
Myom3 A G 4: 135,789,572 T818A probably benign Het
Nacc2 G A 2: 26,090,353 R24C probably damaging Het
Ntrk3 A C 7: 78,247,300 I663R probably damaging Het
Nyap1 A G 5: 137,736,114 V219A probably damaging Het
Obox3 A T 7: 15,626,248 N165K probably damaging Het
Olfr1382 A G 11: 49,535,415 T77A possibly damaging Het
Olfr211 T A 6: 116,493,804 L65* probably null Het
Olfr544 G A 7: 102,484,985 T45I probably benign Het
Olfr589 C A 7: 103,155,386 M120I probably damaging Het
Olfr71 A T 4: 43,706,518 F17I probably damaging Het
Pask A T 1: 93,334,628 L170H probably damaging Het
Piezo2 A T 18: 63,030,409 I2146N possibly damaging Het
Pitpnm2 A T 5: 124,136,386 M220K probably damaging Het
Pkhd1l1 A G 15: 44,505,309 D841G probably benign Het
Pla2g3 C T 11: 3,490,827 T264M probably benign Het
Plcb1 A T 2: 135,262,245 Y278F probably benign Het
Prkdc T C 16: 15,716,035 L1579P probably damaging Het
Rad51ap2 T A 12: 11,457,515 N479K probably benign Het
Rasgrf2 T C 13: 91,896,036 H966R probably damaging Het
Rbm27 A G 18: 42,338,444 D996G probably damaging Het
Rif1 A C 2: 52,120,309 K2337T probably damaging Het
Rpl13a G T 7: 45,125,961 N442K probably benign Het
Serpini2 T A 3: 75,246,513 T380S possibly damaging Het
Setbp1 A T 18: 78,857,999 W818R probably damaging Het
Siae T A 9: 37,631,573 C185S probably benign Het
Slc15a2 A G 16: 36,752,297 V674A probably damaging Het
Slc40a1 A T 1: 45,911,356 M312K possibly damaging Het
Slc46a3 A G 5: 147,886,756 L92S probably damaging Het
Son T C 16: 91,655,699 S445P probably damaging Het
Syne2 T C 12: 76,043,710 F351L probably benign Het
Tmed3 G A 9: 89,699,772 R213* probably null Het
Tmem248 T A 5: 130,240,397 L277H probably damaging Het
Unc13c T A 9: 73,931,475 H698L probably benign Het
Ushbp1 A G 8: 71,395,155 V24A possibly damaging Het
Usp24 G T 4: 106,399,112 probably null Het
Vmn2r50 T G 7: 10,053,043 I46L probably benign Het
Zfp106 T C 2: 120,534,727 T423A probably benign Het
Zfp663 T A 2: 165,353,193 T369S probably benign Het
Zmynd11 T C 13: 9,690,917 T382A probably damaging Het
Other mutations in Arhgef11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Arhgef11 APN 3 87729503 missense probably damaging 1.00
IGL00900:Arhgef11 APN 3 87683560 missense possibly damaging 0.71
IGL01291:Arhgef11 APN 3 87733174 missense probably benign 0.00
IGL01475:Arhgef11 APN 3 87727126 splice site probably benign
IGL01599:Arhgef11 APN 3 87737046 missense probably benign
IGL02251:Arhgef11 APN 3 87683547 missense probably damaging 1.00
IGL02651:Arhgef11 APN 3 87698864 missense probably damaging 0.99
IGL02884:Arhgef11 APN 3 87728006 missense probably damaging 1.00
IGL02900:Arhgef11 APN 3 87733160 missense probably benign 0.07
IGL03017:Arhgef11 APN 3 87717060 nonsense probably null
ANU05:Arhgef11 UTSW 3 87733174 missense probably benign 0.00
R0049:Arhgef11 UTSW 3 87729193 splice site probably null
R0049:Arhgef11 UTSW 3 87729193 splice site probably null
R0129:Arhgef11 UTSW 3 87728063 missense probably damaging 1.00
R0486:Arhgef11 UTSW 3 87688852 unclassified probably null
R0698:Arhgef11 UTSW 3 87733459 missense probably benign 0.24
R0701:Arhgef11 UTSW 3 87733459 missense probably benign 0.24
R0849:Arhgef11 UTSW 3 87735896 missense probably benign 0.24
R1055:Arhgef11 UTSW 3 87717118 missense probably benign 0.19
R1256:Arhgef11 UTSW 3 87727135 missense possibly damaging 0.81
R1401:Arhgef11 UTSW 3 87733469 nonsense probably null
R1543:Arhgef11 UTSW 3 87713017 missense probably benign 0.10
R1547:Arhgef11 UTSW 3 87695402 missense possibly damaging 0.87
R1564:Arhgef11 UTSW 3 87702510 missense probably benign
R1675:Arhgef11 UTSW 3 87731211 missense possibly damaging 0.84
R2082:Arhgef11 UTSW 3 87725996 missense possibly damaging 0.47
R2293:Arhgef11 UTSW 3 87727990 missense probably damaging 1.00
R4739:Arhgef11 UTSW 3 87697999 missense possibly damaging 0.47
R4930:Arhgef11 UTSW 3 87728594 missense probably damaging 1.00
R5130:Arhgef11 UTSW 3 87726014 missense possibly damaging 0.71
R5157:Arhgef11 UTSW 3 87728510 splice site probably null
R5203:Arhgef11 UTSW 3 87735357 missense probably damaging 1.00
R5329:Arhgef11 UTSW 3 87679752 intron probably benign
R5615:Arhgef11 UTSW 3 87722485 critical splice donor site probably null
R5646:Arhgef11 UTSW 3 87684486 missense possibly damaging 0.94
R6125:Arhgef11 UTSW 3 87729602 missense probably damaging 1.00
R6242:Arhgef11 UTSW 3 87728078 missense probably benign
R6543:Arhgef11 UTSW 3 87733408 missense probably benign 0.09
R6801:Arhgef11 UTSW 3 87735852 missense possibly damaging 0.53
R6939:Arhgef11 UTSW 3 87686920 missense probably damaging 1.00
R7008:Arhgef11 UTSW 3 87729218 missense possibly damaging 0.92
R7155:Arhgef11 UTSW 3 87709572 nonsense probably null
R7169:Arhgef11 UTSW 3 87727448 missense possibly damaging 0.79
R7325:Arhgef11 UTSW 3 87713292 missense possibly damaging 0.62
R7392:Arhgef11 UTSW 3 87717175 critical splice donor site probably null
R7683:Arhgef11 UTSW 3 87722383 missense probably damaging 0.98
R7875:Arhgef11 UTSW 3 87684501 missense probably damaging 1.00
R7912:Arhgef11 UTSW 3 87733222 missense probably damaging 1.00
R8028:Arhgef11 UTSW 3 87735552 missense probably benign
R8081:Arhgef11 UTSW 3 87725642 missense probably damaging 1.00
R8118:Arhgef11 UTSW 3 87735857 missense probably damaging 1.00
R8207:Arhgef11 UTSW 3 87698775 missense possibly damaging 0.71
R8290:Arhgef11 UTSW 3 87725968 missense probably damaging 1.00
X0011:Arhgef11 UTSW 3 87722406 missense probably benign
Z1176:Arhgef11 UTSW 3 87735462 missense not run
Predicted Primers PCR Primer
(F):5'- CTGAGGACAGTTGCCATCAG -3'
(R):5'- CTTGACGGTCAGTTGCTCGATG -3'

Sequencing Primer
(F):5'- CCATCAGAAGAGAAAAGGGCCTC -3'
(R):5'- CTCGATGGTGTGGAAGATCAC -3'
Posted On2016-06-21