Incidental Mutation 'R5151:Olfr71'
ID395346
Institutional Source Beutler Lab
Gene Symbol Olfr71
Ensembl Gene ENSMUSG00000046450
Gene Nameolfactory receptor 71
SynonymsGA_x6K02T2N78B-16230286-16231224, mOR17, MOR262-4
MMRRC Submission 042733-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R5151 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location43704562-43710255 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 43706518 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 17 (F17I)
Ref Sequence ENSEMBL: ENSMUSP00000149725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055401] [ENSMUST00000107862] [ENSMUST00000217544]
Predicted Effect probably damaging
Transcript: ENSMUST00000055401
AA Change: F17I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000060230
Gene: ENSMUSG00000046450
AA Change: F17I

DomainStartEndE-ValueType
Pfam:7tm_1 41 290 2.4e-34 PFAM
Pfam:7tm_4 139 283 4.5e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107862
AA Change: F17I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103494
Gene: ENSMUSG00000046450
AA Change: F17I

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 2.2e-52 PFAM
Pfam:7tm_1 41 290 7.5e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217544
AA Change: F17I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1b T A 15: 101,210,770 C476S probably damaging Het
Agpat2 A G 2: 26,597,206 M120T probably damaging Het
Ahnak A G 19: 9,017,569 T5406A probably benign Het
Ano4 A G 10: 89,112,913 F112L probably damaging Het
Arhgef11 T A 3: 87,735,360 V1371D probably damaging Het
Ascc3 A G 10: 50,637,963 N286S probably damaging Het
Ate1 T C 7: 130,507,664 K202E possibly damaging Het
Cacna1d T C 14: 30,123,323 T630A probably damaging Het
Ccdc187 G T 2: 26,293,439 T183N probably damaging Het
Cdk12 C T 11: 98,249,923 probably benign Het
Ciita A G 16: 10,523,730 N978S probably damaging Het
Cit A T 5: 115,979,835 Q1268L probably damaging Het
Csf2rb C T 15: 78,340,581 R180W probably damaging Het
Dnah17 T C 11: 118,027,467 I4079V probably damaging Het
Dnah7a A G 1: 53,620,770 V693A probably benign Het
Dnah8 T A 17: 30,712,295 V1428E probably benign Het
Dnhd1 C A 7: 105,713,440 Q3777K probably benign Het
Dock9 A G 14: 121,578,170 Y1666H probably damaging Het
Dpysl3 C T 18: 43,438,080 G43D probably benign Het
Eftud2 A G 11: 102,867,844 probably null Het
Erich4 T C 7: 25,615,867 probably benign Het
Fah T A 7: 84,601,051 D99V possibly damaging Het
Fat1 T C 8: 44,951,814 V534A possibly damaging Het
Fgf21 G C 7: 45,614,032 S207R probably damaging Het
Fras1 C T 5: 96,645,110 P967S probably damaging Het
H2-T23 T C 17: 36,032,338 D49G probably damaging Het
Hmcn2 A G 2: 31,389,443 N1819S probably null Het
Hoxc12 A G 15: 102,938,446 I258V probably damaging Het
Ighv1-22 T A 12: 114,746,308 T106S probably damaging Het
Inpp5j T C 11: 3,502,270 T327A probably damaging Het
Iqgap3 G T 3: 88,117,760 M689I possibly damaging Het
Itga7 G A 10: 128,944,511 G559S possibly damaging Het
Kcnq1 G T 7: 143,426,012 V632L probably benign Het
Lsamp T C 16: 42,134,429 V230A probably damaging Het
Mfn2 A T 4: 147,886,328 S305T probably benign Het
Myom3 A G 4: 135,789,572 T818A probably benign Het
Nacc2 G A 2: 26,090,353 R24C probably damaging Het
Ntrk3 A C 7: 78,247,300 I663R probably damaging Het
Nyap1 A G 5: 137,736,114 V219A probably damaging Het
Obox3 A T 7: 15,626,248 N165K probably damaging Het
Olfr1382 A G 11: 49,535,415 T77A possibly damaging Het
Olfr211 T A 6: 116,493,804 L65* probably null Het
Olfr544 G A 7: 102,484,985 T45I probably benign Het
Olfr589 C A 7: 103,155,386 M120I probably damaging Het
Pask A T 1: 93,334,628 L170H probably damaging Het
Piezo2 A T 18: 63,030,409 I2146N possibly damaging Het
Pitpnm2 A T 5: 124,136,386 M220K probably damaging Het
Pkhd1l1 A G 15: 44,505,309 D841G probably benign Het
Pla2g3 C T 11: 3,490,827 T264M probably benign Het
Plcb1 A T 2: 135,262,245 Y278F probably benign Het
Prkdc T C 16: 15,716,035 L1579P probably damaging Het
Rad51ap2 T A 12: 11,457,515 N479K probably benign Het
Rasgrf2 T C 13: 91,896,036 H966R probably damaging Het
Rbm27 A G 18: 42,338,444 D996G probably damaging Het
Rif1 A C 2: 52,120,309 K2337T probably damaging Het
Rpl13a G T 7: 45,125,961 N442K probably benign Het
Serpini2 T A 3: 75,246,513 T380S possibly damaging Het
Setbp1 A T 18: 78,857,999 W818R probably damaging Het
Siae T A 9: 37,631,573 C185S probably benign Het
Slc15a2 A G 16: 36,752,297 V674A probably damaging Het
Slc40a1 A T 1: 45,911,356 M312K possibly damaging Het
Slc46a3 A G 5: 147,886,756 L92S probably damaging Het
Son T C 16: 91,655,699 S445P probably damaging Het
Syne2 T C 12: 76,043,710 F351L probably benign Het
Tmed3 G A 9: 89,699,772 R213* probably null Het
Tmem248 T A 5: 130,240,397 L277H probably damaging Het
Unc13c T A 9: 73,931,475 H698L probably benign Het
Ushbp1 A G 8: 71,395,155 V24A possibly damaging Het
Usp24 G T 4: 106,399,112 probably null Het
Vmn2r50 T G 7: 10,053,043 I46L probably benign Het
Zfp106 T C 2: 120,534,727 T423A probably benign Het
Zfp663 T A 2: 165,353,193 T369S probably benign Het
Zmynd11 T C 13: 9,690,917 T382A probably damaging Het
Other mutations in Olfr71
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02317:Olfr71 APN 4 43706172 missense probably damaging 1.00
PIT4453001:Olfr71 UTSW 4 43706464 missense probably damaging 1.00
R0597:Olfr71 UTSW 4 43706592 unclassified probably null
R0610:Olfr71 UTSW 4 43706400 missense possibly damaging 0.69
R1588:Olfr71 UTSW 4 43705923 missense probably damaging 0.98
R1619:Olfr71 UTSW 4 43706292 missense probably damaging 1.00
R1779:Olfr71 UTSW 4 43706041 missense probably damaging 1.00
R2871:Olfr71 UTSW 4 43706458 missense probably benign 0.30
R2871:Olfr71 UTSW 4 43706458 missense probably benign 0.30
R4723:Olfr71 UTSW 4 43705785 missense probably damaging 1.00
R4891:Olfr71 UTSW 4 43706194 missense probably damaging 0.99
R5049:Olfr71 UTSW 4 43706259 missense probably damaging 1.00
R5491:Olfr71 UTSW 4 43705990 missense probably damaging 1.00
R5521:Olfr71 UTSW 4 43705788 missense possibly damaging 0.88
R6225:Olfr71 UTSW 4 43705698 missense probably damaging 1.00
R6518:Olfr71 UTSW 4 43706334 missense probably benign 0.05
R6883:Olfr71 UTSW 4 43705723 missense possibly damaging 0.93
R7185:Olfr71 UTSW 4 43706082 missense possibly damaging 0.82
R7339:Olfr71 UTSW 4 43706080 missense probably benign 0.05
R7502:Olfr71 UTSW 4 43706316 missense probably damaging 0.97
R8052:Olfr71 UTSW 4 43705884 missense probably damaging 0.97
X0017:Olfr71 UTSW 4 43705990 missense probably damaging 1.00
X0021:Olfr71 UTSW 4 43706326 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAAGGAGATGGTCTTCCGGG -3'
(R):5'- ACACGGATGAACTGAAGCC -3'

Sequencing Primer
(F):5'- TGGACCAGCATCAGGGGTAC -3'
(R):5'- CTACAGAGGGTGAGGAGTCTGTC -3'
Posted On2016-06-21