Incidental Mutation 'R5151:Usp24'
ID 395347
Institutional Source Beutler Lab
Gene Symbol Usp24
Ensembl Gene ENSMUSG00000028514
Gene Name ubiquitin specific peptidase 24
Synonyms 2810030C21Rik, 2700066K03Rik
MMRRC Submission 042733-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5151 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 106316213-106441322 bp(+) (GRCm38)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to T at 106399112 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094933] [ENSMUST00000165709]
AlphaFold B1AY13
Predicted Effect probably null
Transcript: ENSMUST00000094933
SMART Domains Protein: ENSMUSP00000092538
Gene: ENSMUSG00000028514

DomainStartEndE-ValueType
Blast:UBA 5 43 2e-16 BLAST
low complexity region 57 96 N/A INTRINSIC
SCOP:d1gw5a_ 348 882 6e-7 SMART
low complexity region 1031 1059 N/A INTRINSIC
low complexity region 1124 1150 N/A INTRINSIC
low complexity region 1365 1378 N/A INTRINSIC
Pfam:UCH 1685 2036 3.7e-54 PFAM
Pfam:UCH_1 1686 1993 1.8e-27 PFAM
low complexity region 2066 2081 N/A INTRINSIC
low complexity region 2256 2267 N/A INTRINSIC
low complexity region 2576 2592 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000165709
SMART Domains Protein: ENSMUSP00000133095
Gene: ENSMUSG00000028514

DomainStartEndE-ValueType
Blast:UBA 5 43 2e-16 BLAST
low complexity region 57 96 N/A INTRINSIC
SCOP:d1gw5a_ 348 883 8e-7 SMART
low complexity region 1032 1060 N/A INTRINSIC
low complexity region 1125 1151 N/A INTRINSIC
low complexity region 1366 1379 N/A INTRINSIC
Pfam:UCH 1686 2037 2e-49 PFAM
Pfam:UCH_1 1687 1994 4e-24 PFAM
low complexity region 2067 2082 N/A INTRINSIC
low complexity region 2257 2268 N/A INTRINSIC
low complexity region 2577 2593 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Modification of cellular proteins by ubiquitin is an essential regulatory mechanism controlled by the coordinated action of multiple ubiquitin-conjugating and deubiquitinating enzymes. USP24 belongs to a large family of cysteine proteases that function as deubiquitinating enzymes (Quesada et al., 2004 [PubMed 14715245]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1b T A 15: 101,210,770 C476S probably damaging Het
Agpat2 A G 2: 26,597,206 M120T probably damaging Het
Ahnak A G 19: 9,017,569 T5406A probably benign Het
Ano4 A G 10: 89,112,913 F112L probably damaging Het
Arhgef11 T A 3: 87,735,360 V1371D probably damaging Het
Ascc3 A G 10: 50,637,963 N286S probably damaging Het
Ate1 T C 7: 130,507,664 K202E possibly damaging Het
Cacna1d T C 14: 30,123,323 T630A probably damaging Het
Ccdc187 G T 2: 26,293,439 T183N probably damaging Het
Cdk12 C T 11: 98,249,923 probably benign Het
Ciita A G 16: 10,523,730 N978S probably damaging Het
Cit A T 5: 115,979,835 Q1268L probably damaging Het
Csf2rb C T 15: 78,340,581 R180W probably damaging Het
Dnah17 T C 11: 118,027,467 I4079V probably damaging Het
Dnah7a A G 1: 53,620,770 V693A probably benign Het
Dnah8 T A 17: 30,712,295 V1428E probably benign Het
Dnhd1 C A 7: 105,713,440 Q3777K probably benign Het
Dock9 A G 14: 121,578,170 Y1666H probably damaging Het
Dpysl3 C T 18: 43,438,080 G43D probably benign Het
Eftud2 A G 11: 102,867,844 probably null Het
Erich4 T C 7: 25,615,867 probably benign Het
Fah T A 7: 84,601,051 D99V possibly damaging Het
Fat1 T C 8: 44,951,814 V534A possibly damaging Het
Fgf21 G C 7: 45,614,032 S207R probably damaging Het
Fras1 C T 5: 96,645,110 P967S probably damaging Het
H2-T23 T C 17: 36,032,338 D49G probably damaging Het
Hmcn2 A G 2: 31,389,443 N1819S probably null Het
Hoxc12 A G 15: 102,938,446 I258V probably damaging Het
Ighv1-22 T A 12: 114,746,308 T106S probably damaging Het
Inpp5j T C 11: 3,502,270 T327A probably damaging Het
Iqgap3 G T 3: 88,117,760 M689I possibly damaging Het
Itga7 G A 10: 128,944,511 G559S possibly damaging Het
Kcnq1 G T 7: 143,426,012 V632L probably benign Het
Lsamp T C 16: 42,134,429 V230A probably damaging Het
Mfn2 A T 4: 147,886,328 S305T probably benign Het
Myom3 A G 4: 135,789,572 T818A probably benign Het
Nacc2 G A 2: 26,090,353 R24C probably damaging Het
Ntrk3 A C 7: 78,247,300 I663R probably damaging Het
Nyap1 A G 5: 137,736,114 V219A probably damaging Het
Obox3 A T 7: 15,626,248 N165K probably damaging Het
Olfr1382 A G 11: 49,535,415 T77A possibly damaging Het
Olfr211 T A 6: 116,493,804 L65* probably null Het
Olfr544 G A 7: 102,484,985 T45I probably benign Het
Olfr589 C A 7: 103,155,386 M120I probably damaging Het
Olfr71 A T 4: 43,706,518 F17I probably damaging Het
Pask A T 1: 93,334,628 L170H probably damaging Het
Piezo2 A T 18: 63,030,409 I2146N possibly damaging Het
Pitpnm2 A T 5: 124,136,386 M220K probably damaging Het
Pkhd1l1 A G 15: 44,505,309 D841G probably benign Het
Pla2g3 C T 11: 3,490,827 T264M probably benign Het
Plcb1 A T 2: 135,262,245 Y278F probably benign Het
Prkdc T C 16: 15,716,035 L1579P probably damaging Het
Rad51ap2 T A 12: 11,457,515 N479K probably benign Het
Rasgrf2 T C 13: 91,896,036 H966R probably damaging Het
Rbm27 A G 18: 42,338,444 D996G probably damaging Het
Rif1 A C 2: 52,120,309 K2337T probably damaging Het
Rpl13a G T 7: 45,125,961 N442K probably benign Het
Serpini2 T A 3: 75,246,513 T380S possibly damaging Het
Setbp1 A T 18: 78,857,999 W818R probably damaging Het
Siae T A 9: 37,631,573 C185S probably benign Het
Slc15a2 A G 16: 36,752,297 V674A probably damaging Het
Slc40a1 A T 1: 45,911,356 M312K possibly damaging Het
Slc46a3 A G 5: 147,886,756 L92S probably damaging Het
Son T C 16: 91,655,699 S445P probably damaging Het
Syne2 T C 12: 76,043,710 F351L probably benign Het
Tmed3 G A 9: 89,699,772 R213* probably null Het
Tmem248 T A 5: 130,240,397 L277H probably damaging Het
Unc13c T A 9: 73,931,475 H698L probably benign Het
Ushbp1 A G 8: 71,395,155 V24A possibly damaging Het
Vmn2r50 T G 7: 10,053,043 I46L probably benign Het
Zfp106 T C 2: 120,534,727 T423A probably benign Het
Zfp663 T A 2: 165,353,193 T369S probably benign Het
Zmynd11 T C 13: 9,690,917 T382A probably damaging Het
Other mutations in Usp24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Usp24 APN 4 106359091 missense probably benign
IGL00340:Usp24 APN 4 106401139 missense probably damaging 0.99
IGL00480:Usp24 APN 4 106368106 missense probably damaging 0.99
IGL00548:Usp24 APN 4 106341298 missense probably damaging 0.96
IGL00655:Usp24 APN 4 106390318 missense probably damaging 0.99
IGL00674:Usp24 APN 4 106372679 splice site probably benign
IGL00718:Usp24 APN 4 106409704 missense probably benign 0.10
IGL00803:Usp24 APN 4 106385526 splice site probably benign
IGL01161:Usp24 APN 4 106436844 missense probably benign 0.02
IGL01344:Usp24 APN 4 106379385 missense possibly damaging 0.73
IGL01374:Usp24 APN 4 106380099 missense possibly damaging 0.86
IGL01485:Usp24 APN 4 106362232 missense probably benign 0.01
IGL01736:Usp24 APN 4 106423461 missense probably benign 0.00
IGL01737:Usp24 APN 4 106387734 missense probably benign 0.03
IGL01862:Usp24 APN 4 106408898 splice site probably benign
IGL01981:Usp24 APN 4 106375768 splice site probably benign
IGL02090:Usp24 APN 4 106411426 missense possibly damaging 0.55
IGL02275:Usp24 APN 4 106387493 missense probably damaging 1.00
IGL02352:Usp24 APN 4 106403925 missense probably damaging 1.00
IGL02359:Usp24 APN 4 106403925 missense probably damaging 1.00
IGL02391:Usp24 APN 4 106407129 missense possibly damaging 0.60
IGL02418:Usp24 APN 4 106436360 missense probably benign 0.07
IGL02537:Usp24 APN 4 106392367 missense probably damaging 1.00
IGL02638:Usp24 APN 4 106438770 splice site probably benign
IGL02638:Usp24 APN 4 106438772 splice site probably benign
IGL02830:Usp24 APN 4 106347387 missense possibly damaging 0.79
IGL03125:Usp24 APN 4 106392402 missense probably benign 0.09
IGL03280:Usp24 APN 4 106380430 missense probably damaging 1.00
IGL03350:Usp24 APN 4 106371079 nonsense probably null
BB010:Usp24 UTSW 4 106428489 missense probably benign
BB020:Usp24 UTSW 4 106428489 missense probably benign
IGL03098:Usp24 UTSW 4 106371033 missense probably benign 0.11
R0035:Usp24 UTSW 4 106368027 missense probably benign 0.18
R0044:Usp24 UTSW 4 106412084 splice site probably benign
R0086:Usp24 UTSW 4 106392360 missense probably damaging 0.98
R0125:Usp24 UTSW 4 106397299 missense possibly damaging 0.76
R0197:Usp24 UTSW 4 106407133 missense probably damaging 1.00
R0240:Usp24 UTSW 4 106414404 nonsense probably null
R0240:Usp24 UTSW 4 106414404 nonsense probably null
R0491:Usp24 UTSW 4 106402105 missense probably benign 0.41
R0687:Usp24 UTSW 4 106420504 missense probably damaging 1.00
R0973:Usp24 UTSW 4 106371079 nonsense probably null
R0973:Usp24 UTSW 4 106413678 splice site probably null
R0973:Usp24 UTSW 4 106371079 nonsense probably null
R0974:Usp24 UTSW 4 106371079 nonsense probably null
R0974:Usp24 UTSW 4 106413678 splice site probably null
R1163:Usp24 UTSW 4 106420960 missense probably benign
R1293:Usp24 UTSW 4 106423553 missense probably benign 0.19
R1333:Usp24 UTSW 4 106342353 missense possibly damaging 0.55
R1476:Usp24 UTSW 4 106361933 missense probably damaging 1.00
R1699:Usp24 UTSW 4 106438827 missense probably damaging 0.99
R1728:Usp24 UTSW 4 106360421 missense possibly damaging 0.85
R1729:Usp24 UTSW 4 106360421 missense possibly damaging 0.85
R1753:Usp24 UTSW 4 106377559 missense probably benign 0.04
R1917:Usp24 UTSW 4 106410286 missense probably damaging 1.00
R2045:Usp24 UTSW 4 106400980 missense possibly damaging 0.54
R2424:Usp24 UTSW 4 106399113 critical splice donor site probably null
R2436:Usp24 UTSW 4 106409645 nonsense probably null
R2513:Usp24 UTSW 4 106379405 splice site probably null
R3824:Usp24 UTSW 4 106379066 missense probably benign
R3831:Usp24 UTSW 4 106362012 critical splice donor site probably null
R3833:Usp24 UTSW 4 106362012 critical splice donor site probably null
R3982:Usp24 UTSW 4 106387883 missense probably benign 0.38
R4022:Usp24 UTSW 4 106379224 splice site probably benign
R4067:Usp24 UTSW 4 106359089 missense possibly damaging 0.68
R4175:Usp24 UTSW 4 106316773 missense probably benign 0.00
R4766:Usp24 UTSW 4 106416048 missense probably damaging 1.00
R4771:Usp24 UTSW 4 106362180 splice site probably null
R4798:Usp24 UTSW 4 106360162 missense possibly damaging 0.82
R4809:Usp24 UTSW 4 106413676 critical splice donor site probably null
R4822:Usp24 UTSW 4 106416047 missense probably damaging 0.98
R4906:Usp24 UTSW 4 106388637 missense probably benign 0.20
R4934:Usp24 UTSW 4 106426546 missense probably benign 0.29
R5074:Usp24 UTSW 4 106420447 missense probably benign 0.12
R5220:Usp24 UTSW 4 106382303 missense possibly damaging 0.69
R5279:Usp24 UTSW 4 106385424 missense possibly damaging 0.94
R5280:Usp24 UTSW 4 106341214 missense probably benign 0.18
R5285:Usp24 UTSW 4 106407033 missense probably benign 0.00
R5292:Usp24 UTSW 4 106418263 missense probably benign 0.06
R5294:Usp24 UTSW 4 106362357 missense possibly damaging 0.53
R5394:Usp24 UTSW 4 106408013 missense probably damaging 1.00
R5517:Usp24 UTSW 4 106375674 missense probably benign 0.02
R5522:Usp24 UTSW 4 106372721 missense probably damaging 1.00
R5546:Usp24 UTSW 4 106416047 missense probably damaging 0.98
R5756:Usp24 UTSW 4 106362483 missense probably damaging 1.00
R5910:Usp24 UTSW 4 106380468 missense probably damaging 0.99
R5972:Usp24 UTSW 4 106368067 missense probably damaging 0.98
R6285:Usp24 UTSW 4 106374100 splice site probably null
R6370:Usp24 UTSW 4 106380521 missense probably null 0.20
R6630:Usp24 UTSW 4 106387835 missense possibly damaging 0.69
R6754:Usp24 UTSW 4 106360420 missense probably damaging 1.00
R7027:Usp24 UTSW 4 106362244 missense probably benign 0.21
R7088:Usp24 UTSW 4 106387546 missense probably damaging 1.00
R7129:Usp24 UTSW 4 106362215 missense probably damaging 1.00
R7131:Usp24 UTSW 4 106382303 missense possibly damaging 0.69
R7156:Usp24 UTSW 4 106387919 critical splice donor site probably null
R7174:Usp24 UTSW 4 106362681 splice site probably null
R7236:Usp24 UTSW 4 106406305 splice site probably null
R7403:Usp24 UTSW 4 106407035 missense possibly damaging 0.79
R7424:Usp24 UTSW 4 106379107 missense probably benign 0.00
R7475:Usp24 UTSW 4 106342353 missense possibly damaging 0.55
R7505:Usp24 UTSW 4 106379079 missense probably damaging 1.00
R7782:Usp24 UTSW 4 106316574 missense probably damaging 1.00
R7900:Usp24 UTSW 4 106409400 missense probably damaging 1.00
R7933:Usp24 UTSW 4 106428489 missense probably benign
R7940:Usp24 UTSW 4 106430544 missense probably damaging 0.98
R8271:Usp24 UTSW 4 106428514 missense probably damaging 0.98
R8348:Usp24 UTSW 4 106368736 missense possibly damaging 0.82
R8448:Usp24 UTSW 4 106368736 missense possibly damaging 0.82
R8483:Usp24 UTSW 4 106373756 missense probably damaging 1.00
R8546:Usp24 UTSW 4 106402129 missense probably benign 0.01
R8798:Usp24 UTSW 4 106379239 missense probably benign 0.00
R8822:Usp24 UTSW 4 106412213 missense probably benign 0.17
R8992:Usp24 UTSW 4 106377565 missense probably benign 0.36
R9002:Usp24 UTSW 4 106418215 missense possibly damaging 0.72
R9037:Usp24 UTSW 4 106379054 missense probably damaging 0.99
R9068:Usp24 UTSW 4 106375678 missense probably benign 0.09
R9096:Usp24 UTSW 4 106397311 missense probably benign 0.00
R9180:Usp24 UTSW 4 106359050 missense possibly damaging 0.71
R9199:Usp24 UTSW 4 106387484 missense probably damaging 1.00
R9201:Usp24 UTSW 4 106420530 missense probably benign 0.36
R9251:Usp24 UTSW 4 106360518 missense probably benign 0.19
R9423:Usp24 UTSW 4 106431670 missense probably damaging 1.00
R9459:Usp24 UTSW 4 106342358 missense probably damaging 1.00
R9472:Usp24 UTSW 4 106403931 missense probably benign 0.00
R9483:Usp24 UTSW 4 106362182 missense probably damaging 0.99
R9534:Usp24 UTSW 4 106407115 missense probably damaging 0.97
R9653:Usp24 UTSW 4 106347367 missense probably benign 0.03
R9712:Usp24 UTSW 4 106347367 missense probably benign 0.03
X0024:Usp24 UTSW 4 106360446 missense probably benign 0.09
X0028:Usp24 UTSW 4 106368055 missense probably benign 0.01
X0066:Usp24 UTSW 4 106355731 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- CTTAGGAAAATTACCTTGCTCAGCTG -3'
(R):5'- GGCACATGGATTTATATGCCATTTC -3'

Sequencing Primer
(F):5'- GAAAATTACCTTGCTCAGCTGCTTTG -3'
(R):5'- TTTAATCCCAGCACTCGGGAG -3'
Posted On 2016-06-21