Mutagenetix > Incidental Mutation

Incidental Mutation 'R5151:Cit'

395352

Institutional Source

Beutler Lab

Gene Symbol

Cit

Ensembl Gene

ENSMUSG00000029516

Gene Name

citron

Synonyms

CRIK-SK, C030025P15Rik, Cit-k, citron-N, citron kinase

MMRRC Submission

042733-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.949) question?

Stock #

R5151 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

115845278-116008947 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 115979835 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 1268 (Q1268L)

Ref Sequence

ENSEMBL: ENSMUSP00000099620 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000051704] [ENSMUST00000102560] [ENSMUST00000112008] [ENSMUST00000141101]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000051704
AA Change: Q1268L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000062049
Gene: ENSMUSG00000029516
AA Change: Q1268L

Domain	Start	End	E-Value	Type
S_TKc	97	359	2.92e-89	SMART
S_TK_X	360	422	6.32e-16	SMART
low complexity region	632	646	N/A	INTRINSIC
low complexity region	891	905	N/A	INTRINSIC
low complexity region	915	948	N/A	INTRINSIC
low complexity region	950	968	N/A	INTRINSIC
low complexity region	1068	1081	N/A	INTRINSIC
low complexity region	1138	1156	N/A	INTRINSIC
low complexity region	1182	1203	N/A	INTRINSIC
internal_repeat_1	1243	1282	1.05e-5	PROSPERO
low complexity region	1353	1364	N/A	INTRINSIC
C1	1389	1437	1.97e-9	SMART
PH	1470	1591	1.31e-8	SMART
CNH	1618	1915	1.78e-112	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000102560
AA Change: Q1268L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000099620
Gene: ENSMUSG00000029516
AA Change: Q1268L

Domain	Start	End	E-Value	Type
S_TKc	97	359	2.92e-89	SMART
S_TK_X	360	422	6.32e-16	SMART
coiled coil region	452	1244	N/A	INTRINSIC
coiled coil region	1297	1338	N/A	INTRINSIC
low complexity region	1368	1379	N/A	INTRINSIC
C1	1404	1452	1.97e-9	SMART
PH	1485	1606	1.31e-8	SMART
CNH	1633	1930	1.78e-112	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000112008
AA Change: Q1226L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000107639
Gene: ENSMUSG00000029516
AA Change: Q1226L

Domain	Start	End	E-Value	Type
S_TKc	97	359	2.92e-89	SMART
S_TK_X	360	422	6.32e-16	SMART
coiled coil region	452	1202	N/A	INTRINSIC
coiled coil region	1255	1296	N/A	INTRINSIC
low complexity region	1326	1337	N/A	INTRINSIC
C1	1362	1410	1.97e-9	SMART
PH	1443	1564	1.31e-8	SMART
CNH	1591	1888	1.78e-112	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122877

Predicted Effect

probably benign
Transcript: ENSMUST00000123736

Predicted Effect

probably damaging
Transcript: ENSMUST00000141101
AA Change: Q1226L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000115802
Gene: ENSMUSG00000029516
AA Change: Q1226L

Domain	Start	End	E-Value	Type
S_TKc	97	359	1.4e-91	SMART
S_TK_X	360	422	3e-18	SMART
low complexity region	632	646	N/A	INTRINSIC
low complexity region	686	698	N/A	INTRINSIC
low complexity region	849	863	N/A	INTRINSIC
low complexity region	873	906	N/A	INTRINSIC
low complexity region	908	926	N/A	INTRINSIC
low complexity region	1026	1039	N/A	INTRINSIC
low complexity region	1096	1114	N/A	INTRINSIC
low complexity region	1140	1161	N/A	INTRINSIC
internal_repeat_1	1201	1240	1.73e-5	PROSPERO
low complexity region	1311	1322	N/A	INTRINSIC
C1	1347	1395	9.7e-12	SMART
PH	1428	1549	6e-11	SMART
CNH	1576	1873	8.6e-115	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145363

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147479

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine-protein kinase that functions in cell division. Together with the kinesin KIF14, this protein localizes to the central spindle and midbody, and functions to promote efficient cytokinesis. This protein is involved in central nervous system development. Polymorphisms in this gene are associated with bipolar disorder and risk for schizophrenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for a null mutation are 20% smaller than wild-type and exhibit tremors, ataxia, and fatal seizures. Brains of mutant mice show a 50% size reduction with abnormalities in the hippocampus, cerebellum, and olfactory lobes. Mutant males show aberrant cytokinesis of spermatogenic precursors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acvr1b	T	A	15: 101,210,770	C476S	probably damaging	Het
Agpat2	A	G	2: 26,597,206	M120T	probably damaging	Het
Ahnak	A	G	19: 9,017,569	T5406A	probably benign	Het
Ano4	A	G	10: 89,112,913	F112L	probably damaging	Het
Arhgef11	T	A	3: 87,735,360	V1371D	probably damaging	Het
Ascc3	A	G	10: 50,637,963	N286S	probably damaging	Het
Ate1	T	C	7: 130,507,664	K202E	possibly damaging	Het
Cacna1d	T	C	14: 30,123,323	T630A	probably damaging	Het
Ccdc187	G	T	2: 26,293,439	T183N	probably damaging	Het
Cdk12	C	T	11: 98,249,923		probably benign	Het
Ciita	A	G	16: 10,523,730	N978S	probably damaging	Het
Csf2rb	C	T	15: 78,340,581	R180W	probably damaging	Het
Dnah17	T	C	11: 118,027,467	I4079V	probably damaging	Het
Dnah7a	A	G	1: 53,620,770	V693A	probably benign	Het
Dnah8	T	A	17: 30,712,295	V1428E	probably benign	Het
Dnhd1	C	A	7: 105,713,440	Q3777K	probably benign	Het
Dock9	A	G	14: 121,578,170	Y1666H	probably damaging	Het
Dpysl3	C	T	18: 43,438,080	G43D	probably benign	Het
Eftud2	A	G	11: 102,867,844		probably null	Het
Erich4	T	C	7: 25,615,867		probably benign	Het
Fah	T	A	7: 84,601,051	D99V	possibly damaging	Het
Fat1	T	C	8: 44,951,814	V534A	possibly damaging	Het
Fgf21	G	C	7: 45,614,032	S207R	probably damaging	Het
Fras1	C	T	5: 96,645,110	P967S	probably damaging	Het
H2-T23	T	C	17: 36,032,338	D49G	probably damaging	Het
Hmcn2	A	G	2: 31,389,443	N1819S	probably null	Het
Hoxc12	A	G	15: 102,938,446	I258V	probably damaging	Het
Ighv1-22	T	A	12: 114,746,308	T106S	probably damaging	Het
Inpp5j	T	C	11: 3,502,270	T327A	probably damaging	Het
Iqgap3	G	T	3: 88,117,760	M689I	possibly damaging	Het
Itga7	G	A	10: 128,944,511	G559S	possibly damaging	Het
Kcnq1	G	T	7: 143,426,012	V632L	probably benign	Het
Lsamp	T	C	16: 42,134,429	V230A	probably damaging	Het
Mfn2	A	T	4: 147,886,328	S305T	probably benign	Het
Myom3	A	G	4: 135,789,572	T818A	probably benign	Het
Nacc2	G	A	2: 26,090,353	R24C	probably damaging	Het
Ntrk3	A	C	7: 78,247,300	I663R	probably damaging	Het
Nyap1	A	G	5: 137,736,114	V219A	probably damaging	Het
Obox3	A	T	7: 15,626,248	N165K	probably damaging	Het
Olfr1382	A	G	11: 49,535,415	T77A	possibly damaging	Het
Olfr211	T	A	6: 116,493,804	L65*	probably null	Het
Olfr544	G	A	7: 102,484,985	T45I	probably benign	Het
Olfr589	C	A	7: 103,155,386	M120I	probably damaging	Het
Olfr71	A	T	4: 43,706,518	F17I	probably damaging	Het
Pask	A	T	1: 93,334,628	L170H	probably damaging	Het
Piezo2	A	T	18: 63,030,409	I2146N	possibly damaging	Het
Pitpnm2	A	T	5: 124,136,386	M220K	probably damaging	Het
Pkhd1l1	A	G	15: 44,505,309	D841G	probably benign	Het
Pla2g3	C	T	11: 3,490,827	T264M	probably benign	Het
Plcb1	A	T	2: 135,262,245	Y278F	probably benign	Het
Prkdc	T	C	16: 15,716,035	L1579P	probably damaging	Het
Rad51ap2	T	A	12: 11,457,515	N479K	probably benign	Het
Rasgrf2	T	C	13: 91,896,036	H966R	probably damaging	Het
Rbm27	A	G	18: 42,338,444	D996G	probably damaging	Het
Rif1	A	C	2: 52,120,309	K2337T	probably damaging	Het
Rpl13a	G	T	7: 45,125,961	N442K	probably benign	Het
Serpini2	T	A	3: 75,246,513	T380S	possibly damaging	Het
Setbp1	A	T	18: 78,857,999	W818R	probably damaging	Het
Siae	T	A	9: 37,631,573	C185S	probably benign	Het
Slc15a2	A	G	16: 36,752,297	V674A	probably damaging	Het
Slc40a1	A	T	1: 45,911,356	M312K	possibly damaging	Het
Slc46a3	A	G	5: 147,886,756	L92S	probably damaging	Het
Son	T	C	16: 91,655,699	S445P	probably damaging	Het
Syne2	T	C	12: 76,043,710	F351L	probably benign	Het
Tmed3	G	A	9: 89,699,772	R213*	probably null	Het
Tmem248	T	A	5: 130,240,397	L277H	probably damaging	Het
Unc13c	T	A	9: 73,931,475	H698L	probably benign	Het
Ushbp1	A	G	8: 71,395,155	V24A	possibly damaging	Het
Usp24	G	T	4: 106,399,112		probably null	Het
Vmn2r50	T	G	7: 10,053,043	I46L	probably benign	Het
Zfp106	T	C	2: 120,534,727	T423A	probably benign	Het
Zfp663	T	A	2: 165,353,193	T369S	probably benign	Het
Zmynd11	T	C	13: 9,690,917	T382A	probably damaging	Het

Other mutations in Cit

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00321:Cit	APN	5	115846465	missense	probably damaging	0.99
IGL00482:Cit	APN	5	115938755	missense	probably damaging	0.97
IGL01317:Cit	APN	5	115908716	missense	probably benign	0.03
IGL01335:Cit	APN	5	115908830	splice site	probably benign
IGL01415:Cit	APN	5	115941903	missense	possibly damaging	0.78
IGL01447:Cit	APN	5	115873843	splice site	probably benign
IGL01537:Cit	APN	5	115933854	missense	probably benign	0.00
IGL01621:Cit	APN	5	115992603	splice site	probably benign
IGL02010:Cit	APN	5	115875947	missense	probably damaging	1.00
IGL02538:Cit	APN	5	115986989	nonsense	probably null
IGL02607:Cit	APN	5	115859209	missense	probably benign
IGL02720:Cit	APN	5	115995452	missense	probably benign	0.26
IGL02725:Cit	APN	5	115985473	missense	probably benign	0.02
IGL02967:Cit	APN	5	115945837	missense	probably benign	0.11
IGL02973:Cit	APN	5	116005999	missense	possibly damaging	0.73
IGL03383:Cit	APN	5	115873845	splice site	probably benign
PIT4514001:Cit	UTSW	5	115997854	critical splice donor site	probably null
R0206:Cit	UTSW	5	115994030	missense	possibly damaging	0.72
R0206:Cit	UTSW	5	115994030	missense	possibly damaging	0.72
R0226:Cit	UTSW	5	115984840	missense	probably damaging	0.99
R0320:Cit	UTSW	5	115979445	missense	possibly damaging	0.87
R0401:Cit	UTSW	5	115985479	missense	probably benign	0.06
R0480:Cit	UTSW	5	115933393	splice site	probably benign
R0609:Cit	UTSW	5	115873943	missense	probably damaging	0.98
R0737:Cit	UTSW	5	115946919	missense	probably damaging	1.00
R1238:Cit	UTSW	5	115851221	missense	probably benign	0.30
R1503:Cit	UTSW	5	115873900	missense	possibly damaging	0.94
R1551:Cit	UTSW	5	115945842	missense	probably benign	0.00
R1602:Cit	UTSW	5	115997730	missense	probably damaging	1.00
R1720:Cit	UTSW	5	115967897	missense	probably damaging	0.98
R1854:Cit	UTSW	5	115873901	missense	probably damaging	1.00
R1886:Cit	UTSW	5	115933486	missense	probably damaging	1.00
R2024:Cit	UTSW	5	115947924	missense	probably damaging	0.97
R2024:Cit	UTSW	5	116005840	missense	probably damaging	0.97
R2048:Cit	UTSW	5	115886813	splice site	probably null
R2128:Cit	UTSW	5	115985507	missense	possibly damaging	0.63
R2192:Cit	UTSW	5	115968009	missense	probably benign	0.00
R2244:Cit	UTSW	5	115926505	missense	probably damaging	1.00
R2518:Cit	UTSW	5	115987046	missense	probably damaging	0.99
R2679:Cit	UTSW	5	115969115	missense	probably benign	0.00
R2898:Cit	UTSW	5	115873978	splice site	probably null
R2908:Cit	UTSW	5	115981676	missense	probably benign	0.00
R3079:Cit	UTSW	5	115925486	missense	probably damaging	0.97
R3779:Cit	UTSW	5	115859341	missense	probably benign	0.01
R4081:Cit	UTSW	5	115948050	missense	probably damaging	1.00
R4494:Cit	UTSW	5	115873984	missense	probably damaging	1.00
R4610:Cit	UTSW	5	115994087	missense	probably benign	0.01
R4757:Cit	UTSW	5	115997549	missense	probably damaging	1.00
R4788:Cit	UTSW	5	115933506	missense	probably damaging	1.00
R4816:Cit	UTSW	5	115908691	missense	probably damaging	1.00
R4890:Cit	UTSW	5	115988123	intron	probably benign
R4899:Cit	UTSW	5	115863028	missense	possibly damaging	0.60
R4928:Cit	UTSW	5	115985797	missense	probably benign	0.00
R5073:Cit	UTSW	5	115946843	missense	probably benign	0.24
R5154:Cit	UTSW	5	115988405	missense	probably damaging	1.00
R5222:Cit	UTSW	5	115952543	missense	probably benign	0.03
R5814:Cit	UTSW	5	115979419	missense	probably damaging	1.00
R5935:Cit	UTSW	5	115925539	intron	probably benign
R5946:Cit	UTSW	5	115997534	missense	probably damaging	1.00
R6051:Cit	UTSW	5	115846405	missense	probably benign
R6289:Cit	UTSW	5	116006326	makesense	probably null
R6298:Cit	UTSW	5	115948065	missense	probably damaging	1.00
R6362:Cit	UTSW	5	115886676	missense	probably benign	0.01
R6545:Cit	UTSW	5	115846434	missense	probably null	0.00
R6761:Cit	UTSW	5	115908675	missense	probably damaging	1.00
R6798:Cit	UTSW	5	115926526	missense	possibly damaging	0.56
R6814:Cit	UTSW	5	115884963	missense	probably damaging	1.00
R6825:Cit	UTSW	5	115981774	missense	probably damaging	0.99
R6845:Cit	UTSW	5	115984888	missense	probably damaging	1.00
R6983:Cit	UTSW	5	115994091	missense	probably damaging	1.00
R7164:Cit	UTSW	5	115985787	missense	possibly damaging	0.94
R7359:Cit	UTSW	5	115926574	missense	probably damaging	1.00
R7597:Cit	UTSW	5	115886681	nonsense	probably null
R7729:Cit	UTSW	5	115984822	missense	possibly damaging	0.87
R7763:Cit	UTSW	5	115987001	missense	probably benign	0.01
R7786:Cit	UTSW	5	115863018	missense	probably benign	0.00
R7799:Cit	UTSW	5	115862968	missense	probably benign	0.00
R8060:Cit	UTSW	5	115908727	missense	probably benign	0.00
R8068:Cit	UTSW	5	115952466	missense	probably damaging	1.00
R8068:Cit	UTSW	5	115982235	missense	probably benign	0.03
R8122:Cit	UTSW	5	115969010	missense	probably damaging	1.00
R8177:Cit	UTSW	5	115988159	missense	probably benign	0.18
R8178:Cit	UTSW	5	115969072	missense	probably damaging	1.00
R8265:Cit	UTSW	5	115988177	missense	probably damaging	1.00
R8359:Cit	UTSW	5	115984544	splice site	probably null
R8397:Cit	UTSW	5	115886797	missense	probably benign
R8489:Cit	UTSW	5	115945903	critical splice donor site	probably null
R8784:Cit	UTSW	5	115846383	nonsense	probably null
R8798:Cit	UTSW	5	115969043	missense	probably damaging	0.99
R8882:Cit	UTSW	5	115863030	missense	probably benign	0.04
R8984:Cit	UTSW	5	115926475	missense	possibly damaging	0.86
R9091:Cit	UTSW	5	115846102	intron	probably benign
R9127:Cit	UTSW	5	115936837	nonsense	probably null
R9204:Cit	UTSW	5	115988439	missense	probably damaging	0.99
R9212:Cit	UTSW	5	115875893	missense	possibly damaging	0.75
R9279:Cit	UTSW	5	115927911	missense	probably damaging	1.00
R9288:Cit	UTSW	5	115985453	missense	probably damaging	1.00
R9377:Cit	UTSW	5	115946855	missense	probably benign	0.04
R9520:Cit	UTSW	5	115941895	nonsense	probably null
Z1088:Cit	UTSW	5	115985533	missense	possibly damaging	0.62
Z1176:Cit	UTSW	5	115986603	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATTCAGTCAGGGCAGGTACC -3'
(R):5'- ACTCTGGTTAGACTTAGACGGG -3'

Sequencing Primer
(F):5'- TCAGGGCAGGTACCATGAC -3'
(R):5'- TAGACTTAGACGGGGTTCTCAAC -3'

Posted On

2016-06-21