Incidental Mutation 'R5151:Pitpnm2'
ID395353
Institutional Source Beutler Lab
Gene Symbol Pitpnm2
Ensembl Gene ENSMUSG00000029406
Gene Namephosphatidylinositol transfer protein, membrane-associated 2
SynonymsNIR3, RDGBA2, Rdgb2
MMRRC Submission 042733-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5151 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location124118690-124249760 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 124136386 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 220 (M220K)
Ref Sequence ENSEMBL: ENSMUSP00000124292 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086123] [ENSMUST00000159677] [ENSMUST00000161273] [ENSMUST00000161938] [ENSMUST00000162812]
Predicted Effect probably damaging
Transcript: ENSMUST00000086123
AA Change: M220K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000083292
Gene: ENSMUSG00000029406
AA Change: M220K

DomainStartEndE-ValueType
Pfam:IP_trans 1 253 6.1e-132 PFAM
low complexity region 298 319 N/A INTRINSIC
low complexity region 333 344 N/A INTRINSIC
low complexity region 507 515 N/A INTRINSIC
Blast:DDHD 548 570 6e-7 BLAST
low complexity region 571 589 N/A INTRINSIC
low complexity region 608 630 N/A INTRINSIC
low complexity region 682 689 N/A INTRINSIC
DDHD 701 895 1.66e-98 SMART
LNS2 1040 1171 3.22e-55 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000159677
AA Change: M220K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000143269
Gene: ENSMUSG00000029406
AA Change: M220K

DomainStartEndE-ValueType
Pfam:IP_trans 1 253 3.2e-130 PFAM
low complexity region 298 319 N/A INTRINSIC
low complexity region 333 344 N/A INTRINSIC
low complexity region 420 436 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161273
AA Change: M220K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000124292
Gene: ENSMUSG00000029406
AA Change: M220K

DomainStartEndE-ValueType
Pfam:IP_trans 1 253 3.2e-129 PFAM
low complexity region 298 319 N/A INTRINSIC
low complexity region 333 344 N/A INTRINSIC
Blast:DDHD 422 670 2e-65 BLAST
low complexity region 682 689 N/A INTRINSIC
DDHD 701 945 7.5e-100 SMART
LNS2 1090 1221 3.1e-59 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161530
Predicted Effect probably damaging
Transcript: ENSMUST00000161938
AA Change: M220K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124111
Gene: ENSMUSG00000029406
AA Change: M220K

DomainStartEndE-ValueType
Pfam:IP_trans 1 251 7.5e-116 PFAM
low complexity region 298 319 N/A INTRINSIC
low complexity region 333 344 N/A INTRINSIC
Blast:DDHD 422 670 2e-65 BLAST
low complexity region 682 689 N/A INTRINSIC
DDHD 701 949 8.37e-104 SMART
LNS2 1094 1225 3.22e-55 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162812
AA Change: M220K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124740
Gene: ENSMUSG00000029406
AA Change: M220K

DomainStartEndE-ValueType
Pfam:IP_trans 1 253 6.1e-132 PFAM
low complexity region 298 319 N/A INTRINSIC
low complexity region 333 344 N/A INTRINSIC
low complexity region 507 515 N/A INTRINSIC
Blast:DDHD 548 570 6e-7 BLAST
low complexity region 571 589 N/A INTRINSIC
low complexity region 608 630 N/A INTRINSIC
low complexity region 682 689 N/A INTRINSIC
DDHD 701 895 1.66e-98 SMART
LNS2 1040 1171 3.22e-55 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PITPNM2 belongs to a family of membrane-associated phosphatidylinositol transfer domain-containing proteins that share homology with the Drosophila retinal degeneration B (rdgB) protein (Ocaka et al., 2005 [PubMed 15627748]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous null mice are viable, fertile, and show no defects pertaining to photoreceptor function or survival. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1b T A 15: 101,210,770 C476S probably damaging Het
Agpat2 A G 2: 26,597,206 M120T probably damaging Het
Ahnak A G 19: 9,017,569 T5406A probably benign Het
Ano4 A G 10: 89,112,913 F112L probably damaging Het
Arhgef11 T A 3: 87,735,360 V1371D probably damaging Het
Ascc3 A G 10: 50,637,963 N286S probably damaging Het
Ate1 T C 7: 130,507,664 K202E possibly damaging Het
Cacna1d T C 14: 30,123,323 T630A probably damaging Het
Ccdc187 G T 2: 26,293,439 T183N probably damaging Het
Cdk12 C T 11: 98,249,923 probably benign Het
Ciita A G 16: 10,523,730 N978S probably damaging Het
Cit A T 5: 115,979,835 Q1268L probably damaging Het
Csf2rb C T 15: 78,340,581 R180W probably damaging Het
Dnah17 T C 11: 118,027,467 I4079V probably damaging Het
Dnah7a A G 1: 53,620,770 V693A probably benign Het
Dnah8 T A 17: 30,712,295 V1428E probably benign Het
Dnhd1 C A 7: 105,713,440 Q3777K probably benign Het
Dock9 A G 14: 121,578,170 Y1666H probably damaging Het
Dpysl3 C T 18: 43,438,080 G43D probably benign Het
Eftud2 A G 11: 102,867,844 probably null Het
Erich4 T C 7: 25,615,867 probably benign Het
Fah T A 7: 84,601,051 D99V possibly damaging Het
Fat1 T C 8: 44,951,814 V534A possibly damaging Het
Fgf21 G C 7: 45,614,032 S207R probably damaging Het
Fras1 C T 5: 96,645,110 P967S probably damaging Het
H2-T23 T C 17: 36,032,338 D49G probably damaging Het
Hmcn2 A G 2: 31,389,443 N1819S probably null Het
Hoxc12 A G 15: 102,938,446 I258V probably damaging Het
Ighv1-22 T A 12: 114,746,308 T106S probably damaging Het
Inpp5j T C 11: 3,502,270 T327A probably damaging Het
Iqgap3 G T 3: 88,117,760 M689I possibly damaging Het
Itga7 G A 10: 128,944,511 G559S possibly damaging Het
Kcnq1 G T 7: 143,426,012 V632L probably benign Het
Lsamp T C 16: 42,134,429 V230A probably damaging Het
Mfn2 A T 4: 147,886,328 S305T probably benign Het
Myom3 A G 4: 135,789,572 T818A probably benign Het
Nacc2 G A 2: 26,090,353 R24C probably damaging Het
Ntrk3 A C 7: 78,247,300 I663R probably damaging Het
Nyap1 A G 5: 137,736,114 V219A probably damaging Het
Obox3 A T 7: 15,626,248 N165K probably damaging Het
Olfr1382 A G 11: 49,535,415 T77A possibly damaging Het
Olfr211 T A 6: 116,493,804 L65* probably null Het
Olfr544 G A 7: 102,484,985 T45I probably benign Het
Olfr589 C A 7: 103,155,386 M120I probably damaging Het
Olfr71 A T 4: 43,706,518 F17I probably damaging Het
Pask A T 1: 93,334,628 L170H probably damaging Het
Piezo2 A T 18: 63,030,409 I2146N possibly damaging Het
Pkhd1l1 A G 15: 44,505,309 D841G probably benign Het
Pla2g3 C T 11: 3,490,827 T264M probably benign Het
Plcb1 A T 2: 135,262,245 Y278F probably benign Het
Prkdc T C 16: 15,716,035 L1579P probably damaging Het
Rad51ap2 T A 12: 11,457,515 N479K probably benign Het
Rasgrf2 T C 13: 91,896,036 H966R probably damaging Het
Rbm27 A G 18: 42,338,444 D996G probably damaging Het
Rif1 A C 2: 52,120,309 K2337T probably damaging Het
Rpl13a G T 7: 45,125,961 N442K probably benign Het
Serpini2 T A 3: 75,246,513 T380S possibly damaging Het
Setbp1 A T 18: 78,857,999 W818R probably damaging Het
Siae T A 9: 37,631,573 C185S probably benign Het
Slc15a2 A G 16: 36,752,297 V674A probably damaging Het
Slc40a1 A T 1: 45,911,356 M312K possibly damaging Het
Slc46a3 A G 5: 147,886,756 L92S probably damaging Het
Son T C 16: 91,655,699 S445P probably damaging Het
Syne2 T C 12: 76,043,710 F351L probably benign Het
Tmed3 G A 9: 89,699,772 R213* probably null Het
Tmem248 T A 5: 130,240,397 L277H probably damaging Het
Unc13c T A 9: 73,931,475 H698L probably benign Het
Ushbp1 A G 8: 71,395,155 V24A possibly damaging Het
Usp24 G T 4: 106,399,112 probably null Het
Vmn2r50 T G 7: 10,053,043 I46L probably benign Het
Zfp106 T C 2: 120,534,727 T423A probably benign Het
Zfp663 T A 2: 165,353,193 T369S probably benign Het
Zmynd11 T C 13: 9,690,917 T382A probably damaging Het
Other mutations in Pitpnm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00930:Pitpnm2 APN 5 124121663 unclassified probably benign
IGL01660:Pitpnm2 APN 5 124123194 missense probably damaging 1.00
IGL02328:Pitpnm2 APN 5 124121414 missense probably damaging 0.99
IGL02340:Pitpnm2 APN 5 124130613 missense probably damaging 1.00
IGL02399:Pitpnm2 APN 5 124140758 splice site probably benign
IGL02719:Pitpnm2 APN 5 124140602 missense probably damaging 1.00
IGL03053:Pitpnm2 APN 5 124143601 missense probably damaging 1.00
IGL03083:Pitpnm2 APN 5 124133382 missense possibly damaging 0.92
PIT4131001:Pitpnm2 UTSW 5 124131115 missense probably benign 0.01
R0058:Pitpnm2 UTSW 5 124124030 missense probably damaging 1.00
R0437:Pitpnm2 UTSW 5 124131089 splice site probably benign
R0530:Pitpnm2 UTSW 5 124131201 missense probably damaging 1.00
R0568:Pitpnm2 UTSW 5 124140517 splice site probably benign
R0926:Pitpnm2 UTSW 5 124131209 missense probably benign 0.10
R1625:Pitpnm2 UTSW 5 124133433 missense probably benign 0.05
R2008:Pitpnm2 UTSW 5 124152621 start codon destroyed probably damaging 0.99
R2120:Pitpnm2 UTSW 5 124127269 missense probably damaging 1.00
R2354:Pitpnm2 UTSW 5 124122919 missense probably damaging 0.99
R2448:Pitpnm2 UTSW 5 124123994 missense probably damaging 1.00
R2509:Pitpnm2 UTSW 5 124136326 missense probably damaging 0.99
R2510:Pitpnm2 UTSW 5 124136326 missense probably damaging 0.99
R2511:Pitpnm2 UTSW 5 124136326 missense probably damaging 0.99
R2520:Pitpnm2 UTSW 5 124129401 missense probably damaging 0.96
R2860:Pitpnm2 UTSW 5 124121437 missense probably damaging 1.00
R2861:Pitpnm2 UTSW 5 124121437 missense probably damaging 1.00
R4407:Pitpnm2 UTSW 5 124152615 missense possibly damaging 0.57
R4417:Pitpnm2 UTSW 5 124123569 missense probably damaging 1.00
R4426:Pitpnm2 UTSW 5 124142123 missense probably benign 0.32
R4458:Pitpnm2 UTSW 5 124121376 missense probably benign 0.00
R4610:Pitpnm2 UTSW 5 124125371 missense probably damaging 0.99
R4786:Pitpnm2 UTSW 5 124121743 nonsense probably null
R4903:Pitpnm2 UTSW 5 124152605 missense probably damaging 1.00
R5315:Pitpnm2 UTSW 5 124121933 missense probably benign 0.18
R5592:Pitpnm2 UTSW 5 124142149 missense probably damaging 1.00
R5792:Pitpnm2 UTSW 5 124130321 nonsense probably null
R6846:Pitpnm2 UTSW 5 124131171 missense probably benign 0.00
R6983:Pitpnm2 UTSW 5 124133406 missense probably damaging 1.00
R7096:Pitpnm2 UTSW 5 124129261 missense possibly damaging 0.69
R7188:Pitpnm2 UTSW 5 124121303 missense probably benign 0.31
R7203:Pitpnm2 UTSW 5 124121459 missense probably damaging 0.96
R7237:Pitpnm2 UTSW 5 124125297 critical splice donor site probably null
R7257:Pitpnm2 UTSW 5 124125356 missense possibly damaging 0.88
R7622:Pitpnm2 UTSW 5 124122027 missense probably benign 0.39
R7677:Pitpnm2 UTSW 5 124123569 missense probably damaging 1.00
R7736:Pitpnm2 UTSW 5 124123030 missense possibly damaging 0.47
R7745:Pitpnm2 UTSW 5 124128705 missense probably benign 0.19
R8041:Pitpnm2 UTSW 5 124121456 missense not run
Predicted Primers PCR Primer
(F):5'- AGAGGTTGTTCCAGATGCC -3'
(R):5'- ACCTCTGACCAAAGCCTTGC -3'

Sequencing Primer
(F):5'- CAGATGCCTGGTCCTTGG -3'
(R):5'- GTACAGCCATTGTGAACTCCTGAG -3'
Posted On2016-06-21