Incidental Mutation 'R5151:Ntrk3'
ID395363
Institutional Source Beutler Lab
Gene Symbol Ntrk3
Ensembl Gene ENSMUSG00000059146
Gene Nameneurotrophic tyrosine kinase, receptor, type 3
SynonymsTrkC
MMRRC Submission 042733-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5151 (G1)
Quality Score120
Status Not validated
Chromosome7
Chromosomal Location78175959-78738012 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 78247300 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Arginine at position 663 (I663R)
Ref Sequence ENSEMBL: ENSMUSP00000141599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039431] [ENSMUST00000193002] [ENSMUST00000195262]
Predicted Effect probably damaging
Transcript: ENSMUST00000039431
AA Change: I663R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037909
Gene: ENSMUSG00000059146
AA Change: I663R

DomainStartEndE-ValueType
LRRNT 31 63 2.46e-4 SMART
LRRCT 160 208 3.58e-12 SMART
IG 216 302 1.24e-8 SMART
Pfam:I-set 308 392 2.4e-8 PFAM
transmembrane domain 430 452 N/A INTRINSIC
TyrKc 538 810 1.49e-145 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000193002
AA Change: I663R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141534
Gene: ENSMUSG00000059146
AA Change: I663R

DomainStartEndE-ValueType
LRRNT 31 63 2.46e-4 SMART
LRRCT 160 208 3.58e-12 SMART
IG 216 302 1.24e-8 SMART
Pfam:I-set 308 392 2.4e-8 PFAM
Pfam:Ig_2 312 392 6.9e-4 PFAM
transmembrane domain 430 452 N/A INTRINSIC
TyrKc 538 824 4.29e-137 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000195262
AA Change: I663R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141599
Gene: ENSMUSG00000059146
AA Change: I663R

DomainStartEndE-ValueType
LRRNT 31 63 1.2e-6 SMART
LRRCT 160 208 1.8e-14 SMART
IG 216 302 5.1e-11 SMART
Pfam:I-set 308 392 4.7e-7 PFAM
Pfam:Ig_2 312 392 1.3e-2 PFAM
transmembrane domain 430 452 N/A INTRINSIC
TyrKc 538 849 9.7e-132 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205868
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurotrophic tyrosine receptor kinase (NTRK) family. This kinase is a membrane-bound receptor that, upon neurotrophin binding, phosphorylates itself and members of the MAPK pathway. Signalling through this kinase leads to cell differentiation and may play a role in the development of proprioceptive neurons that sense body position. Mutations in this gene have been associated with medulloblastomas, secretory breast carcinomas and other cancers. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
PHENOTYPE: Homozygotes for targeted mutations show a range of phenotypes including postnatal death at 2-21 days, cardiac defects, reduced numbers of dorsal root ganglia neurons and germ cells, abnormal motor coordination and posture and abnormal sensory innervation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1b T A 15: 101,210,770 C476S probably damaging Het
Agpat2 A G 2: 26,597,206 M120T probably damaging Het
Ahnak A G 19: 9,017,569 T5406A probably benign Het
Ano4 A G 10: 89,112,913 F112L probably damaging Het
Arhgef11 T A 3: 87,735,360 V1371D probably damaging Het
Ascc3 A G 10: 50,637,963 N286S probably damaging Het
Ate1 T C 7: 130,507,664 K202E possibly damaging Het
Cacna1d T C 14: 30,123,323 T630A probably damaging Het
Ccdc187 G T 2: 26,293,439 T183N probably damaging Het
Cdk12 C T 11: 98,249,923 probably benign Het
Ciita A G 16: 10,523,730 N978S probably damaging Het
Cit A T 5: 115,979,835 Q1268L probably damaging Het
Csf2rb C T 15: 78,340,581 R180W probably damaging Het
Dnah17 T C 11: 118,027,467 I4079V probably damaging Het
Dnah7a A G 1: 53,620,770 V693A probably benign Het
Dnah8 T A 17: 30,712,295 V1428E probably benign Het
Dnhd1 C A 7: 105,713,440 Q3777K probably benign Het
Dock9 A G 14: 121,578,170 Y1666H probably damaging Het
Dpysl3 C T 18: 43,438,080 G43D probably benign Het
Eftud2 A G 11: 102,867,844 probably null Het
Erich4 T C 7: 25,615,867 probably benign Het
Fah T A 7: 84,601,051 D99V possibly damaging Het
Fat1 T C 8: 44,951,814 V534A possibly damaging Het
Fgf21 G C 7: 45,614,032 S207R probably damaging Het
Fras1 C T 5: 96,645,110 P967S probably damaging Het
H2-T23 T C 17: 36,032,338 D49G probably damaging Het
Hmcn2 A G 2: 31,389,443 N1819S probably null Het
Hoxc12 A G 15: 102,938,446 I258V probably damaging Het
Ighv1-22 T A 12: 114,746,308 T106S probably damaging Het
Inpp5j T C 11: 3,502,270 T327A probably damaging Het
Iqgap3 G T 3: 88,117,760 M689I possibly damaging Het
Itga7 G A 10: 128,944,511 G559S possibly damaging Het
Kcnq1 G T 7: 143,426,012 V632L probably benign Het
Lsamp T C 16: 42,134,429 V230A probably damaging Het
Mfn2 A T 4: 147,886,328 S305T probably benign Het
Myom3 A G 4: 135,789,572 T818A probably benign Het
Nacc2 G A 2: 26,090,353 R24C probably damaging Het
Nyap1 A G 5: 137,736,114 V219A probably damaging Het
Obox3 A T 7: 15,626,248 N165K probably damaging Het
Olfr1382 A G 11: 49,535,415 T77A possibly damaging Het
Olfr211 T A 6: 116,493,804 L65* probably null Het
Olfr544 G A 7: 102,484,985 T45I probably benign Het
Olfr589 C A 7: 103,155,386 M120I probably damaging Het
Olfr71 A T 4: 43,706,518 F17I probably damaging Het
Pask A T 1: 93,334,628 L170H probably damaging Het
Piezo2 A T 18: 63,030,409 I2146N possibly damaging Het
Pitpnm2 A T 5: 124,136,386 M220K probably damaging Het
Pkhd1l1 A G 15: 44,505,309 D841G probably benign Het
Pla2g3 C T 11: 3,490,827 T264M probably benign Het
Plcb1 A T 2: 135,262,245 Y278F probably benign Het
Prkdc T C 16: 15,716,035 L1579P probably damaging Het
Rad51ap2 T A 12: 11,457,515 N479K probably benign Het
Rasgrf2 T C 13: 91,896,036 H966R probably damaging Het
Rbm27 A G 18: 42,338,444 D996G probably damaging Het
Rif1 A C 2: 52,120,309 K2337T probably damaging Het
Rpl13a G T 7: 45,125,961 N442K probably benign Het
Serpini2 T A 3: 75,246,513 T380S possibly damaging Het
Setbp1 A T 18: 78,857,999 W818R probably damaging Het
Siae T A 9: 37,631,573 C185S probably benign Het
Slc15a2 A G 16: 36,752,297 V674A probably damaging Het
Slc40a1 A T 1: 45,911,356 M312K possibly damaging Het
Slc46a3 A G 5: 147,886,756 L92S probably damaging Het
Son T C 16: 91,655,699 S445P probably damaging Het
Syne2 T C 12: 76,043,710 F351L probably benign Het
Tmed3 G A 9: 89,699,772 R213* probably null Het
Tmem248 T A 5: 130,240,397 L277H probably damaging Het
Unc13c T A 9: 73,931,475 H698L probably benign Het
Ushbp1 A G 8: 71,395,155 V24A possibly damaging Het
Usp24 G T 4: 106,399,112 probably null Het
Vmn2r50 T G 7: 10,053,043 I46L probably benign Het
Zfp106 T C 2: 120,534,727 T423A probably benign Het
Zfp663 T A 2: 165,353,193 T369S probably benign Het
Zmynd11 T C 13: 9,690,917 T382A probably damaging Het
Other mutations in Ntrk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Ntrk3 APN 7 78250873 missense probably benign 0.03
IGL00862:Ntrk3 APN 7 78247177 missense probably damaging 1.00
IGL00972:Ntrk3 APN 7 78247322 missense possibly damaging 0.95
IGL00976:Ntrk3 APN 7 78450953 missense probably benign 0.02
IGL02172:Ntrk3 APN 7 78460272 splice site probably benign
IGL02175:Ntrk3 APN 7 78247228 missense probably damaging 1.00
IGL02213:Ntrk3 APN 7 78462931 missense probably benign 0.17
IGL02363:Ntrk3 APN 7 78453337 missense probably benign 0.24
IGL02527:Ntrk3 APN 7 78451949 missense probably benign
IGL02673:Ntrk3 APN 7 78250764 missense probably damaging 1.00
IGL02755:Ntrk3 APN 7 78460439 missense probably benign
IGL02998:Ntrk3 APN 7 78577657 missense probably damaging 0.98
IGL03235:Ntrk3 APN 7 78192592 missense probably damaging 1.00
R1465:Ntrk3 UTSW 7 78356014 splice site probably benign
R1505:Ntrk3 UTSW 7 78460524 missense probably damaging 0.99
R1638:Ntrk3 UTSW 7 78247288 missense probably damaging 1.00
R1641:Ntrk3 UTSW 7 78356074 missense probably damaging 1.00
R1775:Ntrk3 UTSW 7 78356041 missense possibly damaging 0.60
R1786:Ntrk3 UTSW 7 78477935 splice site probably benign
R1827:Ntrk3 UTSW 7 78247301 missense probably damaging 1.00
R1868:Ntrk3 UTSW 7 78192604 missense possibly damaging 0.90
R1873:Ntrk3 UTSW 7 78462839 missense probably benign
R1929:Ntrk3 UTSW 7 78516723 splice site probably null
R1941:Ntrk3 UTSW 7 78247262 missense probably damaging 1.00
R2132:Ntrk3 UTSW 7 78477935 splice site probably benign
R2214:Ntrk3 UTSW 7 78516772 missense probably damaging 1.00
R2221:Ntrk3 UTSW 7 78198852 missense probably damaging 1.00
R2223:Ntrk3 UTSW 7 78198852 missense probably damaging 1.00
R2271:Ntrk3 UTSW 7 78516723 splice site probably null
R2441:Ntrk3 UTSW 7 78302662 missense probably damaging 1.00
R3108:Ntrk3 UTSW 7 78460515 missense probably benign 0.01
R3109:Ntrk3 UTSW 7 78460515 missense probably benign 0.01
R3959:Ntrk3 UTSW 7 78198842 missense probably damaging 1.00
R4016:Ntrk3 UTSW 7 78462947 splice site probably benign
R4028:Ntrk3 UTSW 7 78192710 missense probably damaging 1.00
R4067:Ntrk3 UTSW 7 78517437 missense probably damaging 1.00
R4398:Ntrk3 UTSW 7 78250769 nonsense probably null
R4664:Ntrk3 UTSW 7 78461099 missense probably damaging 0.99
R5045:Ntrk3 UTSW 7 78460424 missense probably benign 0.13
R5081:Ntrk3 UTSW 7 78577774 missense probably damaging 0.99
R5249:Ntrk3 UTSW 7 78461166 missense possibly damaging 0.87
R5294:Ntrk3 UTSW 7 78517506 splice site probably null
R5594:Ntrk3 UTSW 7 78451899 missense probably benign 0.10
R5923:Ntrk3 UTSW 7 78451928 missense possibly damaging 0.61
R6878:Ntrk3 UTSW 7 78304372 missense probably benign 0.00
R7083:Ntrk3 UTSW 7 78250839 missense probably damaging 1.00
R7178:Ntrk3 UTSW 7 78356147 missense possibly damaging 0.86
R7487:Ntrk3 UTSW 7 78250713 missense probably damaging 1.00
R7607:Ntrk3 UTSW 7 78250873 missense probably benign 0.03
R7800:Ntrk3 UTSW 7 78302740 missense probably benign 0.09
R7961:Ntrk3 UTSW 7 78453328 missense probably benign
R7976:Ntrk3 UTSW 7 78356206 missense probably damaging 0.97
R8009:Ntrk3 UTSW 7 78453328 missense probably benign
R8032:Ntrk3 UTSW 7 78356059 missense probably damaging 1.00
R8104:Ntrk3 UTSW 7 78577702 missense probably damaging 0.99
R8230:Ntrk3 UTSW 7 78250770 missense probably damaging 1.00
R8254:Ntrk3 UTSW 7 78192578 missense probably damaging 1.00
R8412:Ntrk3 UTSW 7 78356149 missense probably benign 0.02
R8465:Ntrk3 UTSW 7 78462883 missense probably damaging 0.99
R8841:Ntrk3 UTSW 7 78356093 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGACATGTAAGCAAGGCAC -3'
(R):5'- TTCTGAAGGATGTTCCAGAGCC -3'

Sequencing Primer
(F):5'- AGCAACTTAGTCCTGCAGCTG -3'
(R):5'- ATGATCCTCGTGGATGGA -3'
Posted On2016-06-21