Incidental Mutation 'R5151:Eftud2'
ID 395386
Institutional Source Beutler Lab
Gene Symbol Eftud2
Ensembl Gene ENSMUSG00000020929
Gene Name elongation factor Tu GTP binding domain containing 2
Synonyms 116kDa, Snrp116, U5-116kD
MMRRC Submission 042733-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5151 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 102729299-102771811 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 102758670 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021306] [ENSMUST00000107060] [ENSMUST00000138483] [ENSMUST00000173679]
AlphaFold O08810
Predicted Effect probably null
Transcript: ENSMUST00000021306
SMART Domains Protein: ENSMUSP00000021306
Gene: ENSMUSG00000020929

DomainStartEndE-ValueType
Pfam:EFTUD2 3 110 1.1e-42 PFAM
Pfam:GTP_EFTU 127 440 9.6e-47 PFAM
Pfam:GTP_EFTU_D2 489 566 3.8e-15 PFAM
Pfam:EFG_II 584 656 9.9e-11 PFAM
EFG_IV 703 824 1.1e-16 SMART
EFG_C 826 915 1.14e-14 SMART
Predicted Effect probably null
Transcript: ENSMUST00000107060
SMART Domains Protein: ENSMUSP00000102675
Gene: ENSMUSG00000020929

DomainStartEndE-ValueType
low complexity region 16 26 N/A INTRINSIC
low complexity region 32 50 N/A INTRINSIC
Pfam:GTP_EFTU 126 439 9.6e-44 PFAM
Pfam:Miro 130 260 2.5e-6 PFAM
Pfam:GTP_EFTU_D2 488 565 7.9e-13 PFAM
Pfam:EFG_II 583 655 8.2e-10 PFAM
EFG_IV 702 823 1.1e-16 SMART
EFG_C 825 914 1.14e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123833
Predicted Effect probably benign
Transcript: ENSMUST00000138483
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147368
Predicted Effect probably null
Transcript: ENSMUST00000173679
SMART Domains Protein: ENSMUSP00000134327
Gene: ENSMUSG00000020929

DomainStartEndE-ValueType
low complexity region 16 26 N/A INTRINSIC
low complexity region 29 51 N/A INTRINSIC
Pfam:GTP_EFTU 127 430 2.2e-36 PFAM
Pfam:GTP_EFTU_D2 479 556 7.8e-13 PFAM
Pfam:EFG_II 574 646 8.1e-10 PFAM
EFG_IV 693 814 1.1e-16 SMART
EFG_C 816 905 1.14e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173974
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181125
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GTPase which is a component of the spliceosome complex which processes precursor mRNAs to produce mature mRNAs. Mutations in this gene are associated with mandibulofacial dysostosis with microcephaly. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1b T A 15: 101,108,651 (GRCm39) C476S probably damaging Het
Agpat2 A G 2: 26,487,218 (GRCm39) M120T probably damaging Het
Ahnak A G 19: 8,994,933 (GRCm39) T5406A probably benign Het
Ano4 A G 10: 88,948,775 (GRCm39) F112L probably damaging Het
Arhgef11 T A 3: 87,642,667 (GRCm39) V1371D probably damaging Het
Ascc3 A G 10: 50,514,059 (GRCm39) N286S probably damaging Het
Ate1 T C 7: 130,109,394 (GRCm39) K202E possibly damaging Het
Cacna1d T C 14: 29,845,280 (GRCm39) T630A probably damaging Het
Ccdc187 G T 2: 26,183,451 (GRCm39) T183N probably damaging Het
Cdk12 C T 11: 98,140,749 (GRCm39) probably benign Het
Ciita A G 16: 10,341,594 (GRCm39) N978S probably damaging Het
Cit A T 5: 116,117,894 (GRCm39) Q1268L probably damaging Het
Csf2rb C T 15: 78,224,781 (GRCm39) R180W probably damaging Het
Dnah17 T C 11: 117,918,293 (GRCm39) I4079V probably damaging Het
Dnah7a A G 1: 53,659,929 (GRCm39) V693A probably benign Het
Dnah8 T A 17: 30,931,269 (GRCm39) V1428E probably benign Het
Dnhd1 C A 7: 105,362,647 (GRCm39) Q3777K probably benign Het
Dock9 A G 14: 121,815,582 (GRCm39) Y1666H probably damaging Het
Dpysl3 C T 18: 43,571,145 (GRCm39) G43D probably benign Het
Erich4 T C 7: 25,315,292 (GRCm39) probably benign Het
Fah T A 7: 84,250,259 (GRCm39) D99V possibly damaging Het
Fat1 T C 8: 45,404,851 (GRCm39) V534A possibly damaging Het
Fgf21 G C 7: 45,263,456 (GRCm39) S207R probably damaging Het
Fras1 C T 5: 96,792,969 (GRCm39) P967S probably damaging Het
H2-T23 T C 17: 36,343,230 (GRCm39) D49G probably damaging Het
Hmcn2 A G 2: 31,279,455 (GRCm39) N1819S probably null Het
Hoxc12 A G 15: 102,846,881 (GRCm39) I258V probably damaging Het
Ighv1-22 T A 12: 114,709,928 (GRCm39) T106S probably damaging Het
Inpp5j T C 11: 3,452,270 (GRCm39) T327A probably damaging Het
Iqgap3 G T 3: 88,025,067 (GRCm39) M689I possibly damaging Het
Itga7 G A 10: 128,780,380 (GRCm39) G559S possibly damaging Het
Kcnq1 G T 7: 142,979,749 (GRCm39) V632L probably benign Het
Lsamp T C 16: 41,954,792 (GRCm39) V230A probably damaging Het
Mfn2 A T 4: 147,970,785 (GRCm39) S305T probably benign Het
Myom3 A G 4: 135,516,883 (GRCm39) T818A probably benign Het
Nacc2 G A 2: 25,980,365 (GRCm39) R24C probably damaging Het
Ntrk3 A C 7: 77,897,048 (GRCm39) I663R probably damaging Het
Nyap1 A G 5: 137,734,376 (GRCm39) V219A probably damaging Het
Obox3 A T 7: 15,360,173 (GRCm39) N165K probably damaging Het
Or13a1 T A 6: 116,470,765 (GRCm39) L65* probably null Het
Or13j1 A T 4: 43,706,518 (GRCm39) F17I probably damaging Het
Or2y12 A G 11: 49,426,242 (GRCm39) T77A possibly damaging Het
Or52e2 C A 7: 102,804,593 (GRCm39) M120I probably damaging Het
Or55b4 G A 7: 102,134,192 (GRCm39) T45I probably benign Het
Pask A T 1: 93,262,350 (GRCm39) L170H probably damaging Het
Piezo2 A T 18: 63,163,480 (GRCm39) I2146N possibly damaging Het
Pitpnm2 A T 5: 124,274,449 (GRCm39) M220K probably damaging Het
Pkhd1l1 A G 15: 44,368,705 (GRCm39) D841G probably benign Het
Pla2g3 C T 11: 3,440,827 (GRCm39) T264M probably benign Het
Plcb1 A T 2: 135,104,165 (GRCm39) Y278F probably benign Het
Prkdc T C 16: 15,533,899 (GRCm39) L1579P probably damaging Het
Rad51ap2 T A 12: 11,507,516 (GRCm39) N479K probably benign Het
Rasgrf2 T C 13: 92,044,155 (GRCm39) H966R probably damaging Het
Rbm27 A G 18: 42,471,509 (GRCm39) D996G probably damaging Het
Rif1 A C 2: 52,010,321 (GRCm39) K2337T probably damaging Het
Rpl13a G T 7: 44,775,385 (GRCm39) N442K probably benign Het
Serpini2 T A 3: 75,153,820 (GRCm39) T380S possibly damaging Het
Setbp1 A T 18: 78,901,214 (GRCm39) W818R probably damaging Het
Siae T A 9: 37,542,869 (GRCm39) C185S probably benign Het
Slc15a2 A G 16: 36,572,659 (GRCm39) V674A probably damaging Het
Slc40a1 A T 1: 45,950,516 (GRCm39) M312K possibly damaging Het
Slc46a3 A G 5: 147,823,566 (GRCm39) L92S probably damaging Het
Son T C 16: 91,452,587 (GRCm39) S445P probably damaging Het
Syne2 T C 12: 76,090,484 (GRCm39) F351L probably benign Het
Tmed3 G A 9: 89,581,825 (GRCm39) R213* probably null Het
Tmem248 T A 5: 130,269,238 (GRCm39) L277H probably damaging Het
Unc13c T A 9: 73,838,757 (GRCm39) H698L probably benign Het
Ushbp1 A G 8: 71,847,799 (GRCm39) V24A possibly damaging Het
Usp24 G T 4: 106,256,309 (GRCm39) probably null Het
Vmn2r50 T G 7: 9,786,970 (GRCm39) I46L probably benign Het
Zfp106 T C 2: 120,365,208 (GRCm39) T423A probably benign Het
Zfp663 T A 2: 165,195,113 (GRCm39) T369S probably benign Het
Zmynd11 T C 13: 9,740,953 (GRCm39) T382A probably damaging Het
Other mutations in Eftud2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Eftud2 APN 11 102,756,389 (GRCm39) splice site probably benign
IGL01765:Eftud2 APN 11 102,730,082 (GRCm39) missense probably damaging 0.99
IGL01868:Eftud2 APN 11 102,759,953 (GRCm39) missense probably benign 0.08
IGL02161:Eftud2 APN 11 102,745,702 (GRCm39) splice site probably benign
IGL02165:Eftud2 APN 11 102,742,573 (GRCm39) splice site probably benign
IGL02218:Eftud2 APN 11 102,761,039 (GRCm39) missense possibly damaging 0.46
IGL02386:Eftud2 APN 11 102,742,580 (GRCm39) splice site probably null
IGL02664:Eftud2 APN 11 102,732,538 (GRCm39) missense probably damaging 1.00
IGL02677:Eftud2 APN 11 102,737,440 (GRCm39) missense probably damaging 1.00
IGL02792:Eftud2 APN 11 102,761,082 (GRCm39) splice site probably benign
IGL02870:Eftud2 APN 11 102,753,452 (GRCm39) missense probably damaging 0.97
IGL03131:Eftud2 APN 11 102,761,009 (GRCm39) missense probably damaging 1.00
R0137:Eftud2 UTSW 11 102,759,443 (GRCm39) missense possibly damaging 0.94
R0244:Eftud2 UTSW 11 102,755,551 (GRCm39) missense probably damaging 0.97
R0358:Eftud2 UTSW 11 102,755,627 (GRCm39) splice site probably benign
R0463:Eftud2 UTSW 11 102,755,597 (GRCm39) missense probably damaging 1.00
R0511:Eftud2 UTSW 11 102,735,048 (GRCm39) missense probably damaging 1.00
R0525:Eftud2 UTSW 11 102,730,079 (GRCm39) missense probably damaging 1.00
R0586:Eftud2 UTSW 11 102,737,446 (GRCm39) missense probably damaging 1.00
R0751:Eftud2 UTSW 11 102,730,079 (GRCm39) missense probably damaging 1.00
R1034:Eftud2 UTSW 11 102,740,010 (GRCm39) missense probably benign
R1079:Eftud2 UTSW 11 102,730,870 (GRCm39) nonsense probably null
R1208:Eftud2 UTSW 11 102,755,592 (GRCm39) missense probably benign 0.22
R1208:Eftud2 UTSW 11 102,755,592 (GRCm39) missense probably benign 0.22
R1220:Eftud2 UTSW 11 102,742,573 (GRCm39) splice site probably benign
R1438:Eftud2 UTSW 11 102,750,868 (GRCm39) missense probably damaging 1.00
R1520:Eftud2 UTSW 11 102,730,266 (GRCm39) missense probably damaging 1.00
R1569:Eftud2 UTSW 11 102,745,597 (GRCm39) splice site probably benign
R2270:Eftud2 UTSW 11 102,755,607 (GRCm39) missense probably damaging 1.00
R3500:Eftud2 UTSW 11 102,735,006 (GRCm39) missense probably damaging 1.00
R3686:Eftud2 UTSW 11 102,735,027 (GRCm39) missense probably damaging 1.00
R3687:Eftud2 UTSW 11 102,735,027 (GRCm39) missense probably damaging 1.00
R3688:Eftud2 UTSW 11 102,735,027 (GRCm39) missense probably damaging 1.00
R3808:Eftud2 UTSW 11 102,732,289 (GRCm39) splice site probably null
R3892:Eftud2 UTSW 11 102,737,013 (GRCm39) missense probably damaging 0.99
R4003:Eftud2 UTSW 11 102,750,936 (GRCm39) missense possibly damaging 0.51
R4091:Eftud2 UTSW 11 102,730,242 (GRCm39) splice site probably null
R4794:Eftud2 UTSW 11 102,761,003 (GRCm39) missense probably benign 0.14
R4841:Eftud2 UTSW 11 102,745,640 (GRCm39) missense probably damaging 1.00
R4842:Eftud2 UTSW 11 102,745,640 (GRCm39) missense probably damaging 1.00
R5208:Eftud2 UTSW 11 102,732,011 (GRCm39) missense probably damaging 1.00
R6199:Eftud2 UTSW 11 102,730,883 (GRCm39) missense probably damaging 1.00
R6357:Eftud2 UTSW 11 102,755,606 (GRCm39) missense probably damaging 1.00
R6720:Eftud2 UTSW 11 102,729,449 (GRCm39) nonsense probably null
R7604:Eftud2 UTSW 11 102,738,838 (GRCm39) missense possibly damaging 0.87
R7886:Eftud2 UTSW 11 102,730,934 (GRCm39) missense probably damaging 1.00
R8017:Eftud2 UTSW 11 102,734,174 (GRCm39) critical splice donor site probably null
R8019:Eftud2 UTSW 11 102,734,174 (GRCm39) critical splice donor site probably null
R8139:Eftud2 UTSW 11 102,758,685 (GRCm39) missense probably benign 0.04
R8431:Eftud2 UTSW 11 102,737,062 (GRCm39) missense probably benign 0.08
R8545:Eftud2 UTSW 11 102,731,097 (GRCm39) missense probably damaging 1.00
R8676:Eftud2 UTSW 11 102,759,447 (GRCm39) missense probably damaging 1.00
R9089:Eftud2 UTSW 11 102,759,971 (GRCm39) missense probably benign
R9173:Eftud2 UTSW 11 102,734,242 (GRCm39) missense probably damaging 1.00
R9277:Eftud2 UTSW 11 102,750,855 (GRCm39) missense probably damaging 1.00
R9313:Eftud2 UTSW 11 102,730,262 (GRCm39) missense probably benign 0.03
R9604:Eftud2 UTSW 11 102,737,056 (GRCm39) missense probably benign 0.11
R9664:Eftud2 UTSW 11 102,759,422 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TATATTCAAGGGCTGGGAGGCTC -3'
(R):5'- CTCGTTGACTGGAGTTACTCTGC -3'

Sequencing Primer
(F):5'- GCTCTGCCCCCGTACTCAG -3'
(R):5'- GAGTTACTCTGCGGACACTCTG -3'
Posted On 2016-06-21