Incidental Mutation 'R5151:Rad51ap2'
ID 395388
Institutional Source Beutler Lab
Gene Symbol Rad51ap2
Ensembl Gene ENSMUSG00000086022
Gene Name RAD51 associated protein 2
Synonyms
MMRRC Submission 042733-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5151 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 11506080-11512929 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 11507516 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 479 (N479K)
Ref Sequence ENSEMBL: ENSMUSP00000128854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124065]
AlphaFold G3UW63
Predicted Effect probably benign
Transcript: ENSMUST00000124065
AA Change: N479K

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000128854
Gene: ENSMUSG00000086022
AA Change: N479K

DomainStartEndE-ValueType
low complexity region 17 32 N/A INTRINSIC
low complexity region 428 438 N/A INTRINSIC
low complexity region 702 713 N/A INTRINSIC
Pfam:RAD51_interact 937 975 1.3e-20 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1b T A 15: 101,108,651 (GRCm39) C476S probably damaging Het
Agpat2 A G 2: 26,487,218 (GRCm39) M120T probably damaging Het
Ahnak A G 19: 8,994,933 (GRCm39) T5406A probably benign Het
Ano4 A G 10: 88,948,775 (GRCm39) F112L probably damaging Het
Arhgef11 T A 3: 87,642,667 (GRCm39) V1371D probably damaging Het
Ascc3 A G 10: 50,514,059 (GRCm39) N286S probably damaging Het
Ate1 T C 7: 130,109,394 (GRCm39) K202E possibly damaging Het
Cacna1d T C 14: 29,845,280 (GRCm39) T630A probably damaging Het
Ccdc187 G T 2: 26,183,451 (GRCm39) T183N probably damaging Het
Cdk12 C T 11: 98,140,749 (GRCm39) probably benign Het
Ciita A G 16: 10,341,594 (GRCm39) N978S probably damaging Het
Cit A T 5: 116,117,894 (GRCm39) Q1268L probably damaging Het
Csf2rb C T 15: 78,224,781 (GRCm39) R180W probably damaging Het
Dnah17 T C 11: 117,918,293 (GRCm39) I4079V probably damaging Het
Dnah7a A G 1: 53,659,929 (GRCm39) V693A probably benign Het
Dnah8 T A 17: 30,931,269 (GRCm39) V1428E probably benign Het
Dnhd1 C A 7: 105,362,647 (GRCm39) Q3777K probably benign Het
Dock9 A G 14: 121,815,582 (GRCm39) Y1666H probably damaging Het
Dpysl3 C T 18: 43,571,145 (GRCm39) G43D probably benign Het
Eftud2 A G 11: 102,758,670 (GRCm39) probably null Het
Erich4 T C 7: 25,315,292 (GRCm39) probably benign Het
Fah T A 7: 84,250,259 (GRCm39) D99V possibly damaging Het
Fat1 T C 8: 45,404,851 (GRCm39) V534A possibly damaging Het
Fgf21 G C 7: 45,263,456 (GRCm39) S207R probably damaging Het
Fras1 C T 5: 96,792,969 (GRCm39) P967S probably damaging Het
H2-T23 T C 17: 36,343,230 (GRCm39) D49G probably damaging Het
Hmcn2 A G 2: 31,279,455 (GRCm39) N1819S probably null Het
Hoxc12 A G 15: 102,846,881 (GRCm39) I258V probably damaging Het
Ighv1-22 T A 12: 114,709,928 (GRCm39) T106S probably damaging Het
Inpp5j T C 11: 3,452,270 (GRCm39) T327A probably damaging Het
Iqgap3 G T 3: 88,025,067 (GRCm39) M689I possibly damaging Het
Itga7 G A 10: 128,780,380 (GRCm39) G559S possibly damaging Het
Kcnq1 G T 7: 142,979,749 (GRCm39) V632L probably benign Het
Lsamp T C 16: 41,954,792 (GRCm39) V230A probably damaging Het
Mfn2 A T 4: 147,970,785 (GRCm39) S305T probably benign Het
Myom3 A G 4: 135,516,883 (GRCm39) T818A probably benign Het
Nacc2 G A 2: 25,980,365 (GRCm39) R24C probably damaging Het
Ntrk3 A C 7: 77,897,048 (GRCm39) I663R probably damaging Het
Nyap1 A G 5: 137,734,376 (GRCm39) V219A probably damaging Het
Obox3 A T 7: 15,360,173 (GRCm39) N165K probably damaging Het
Or13a1 T A 6: 116,470,765 (GRCm39) L65* probably null Het
Or13j1 A T 4: 43,706,518 (GRCm39) F17I probably damaging Het
Or2y12 A G 11: 49,426,242 (GRCm39) T77A possibly damaging Het
Or52e2 C A 7: 102,804,593 (GRCm39) M120I probably damaging Het
Or55b4 G A 7: 102,134,192 (GRCm39) T45I probably benign Het
Pask A T 1: 93,262,350 (GRCm39) L170H probably damaging Het
Piezo2 A T 18: 63,163,480 (GRCm39) I2146N possibly damaging Het
Pitpnm2 A T 5: 124,274,449 (GRCm39) M220K probably damaging Het
Pkhd1l1 A G 15: 44,368,705 (GRCm39) D841G probably benign Het
Pla2g3 C T 11: 3,440,827 (GRCm39) T264M probably benign Het
Plcb1 A T 2: 135,104,165 (GRCm39) Y278F probably benign Het
Prkdc T C 16: 15,533,899 (GRCm39) L1579P probably damaging Het
Rasgrf2 T C 13: 92,044,155 (GRCm39) H966R probably damaging Het
Rbm27 A G 18: 42,471,509 (GRCm39) D996G probably damaging Het
Rif1 A C 2: 52,010,321 (GRCm39) K2337T probably damaging Het
Rpl13a G T 7: 44,775,385 (GRCm39) N442K probably benign Het
Serpini2 T A 3: 75,153,820 (GRCm39) T380S possibly damaging Het
Setbp1 A T 18: 78,901,214 (GRCm39) W818R probably damaging Het
Siae T A 9: 37,542,869 (GRCm39) C185S probably benign Het
Slc15a2 A G 16: 36,572,659 (GRCm39) V674A probably damaging Het
Slc40a1 A T 1: 45,950,516 (GRCm39) M312K possibly damaging Het
Slc46a3 A G 5: 147,823,566 (GRCm39) L92S probably damaging Het
Son T C 16: 91,452,587 (GRCm39) S445P probably damaging Het
Syne2 T C 12: 76,090,484 (GRCm39) F351L probably benign Het
Tmed3 G A 9: 89,581,825 (GRCm39) R213* probably null Het
Tmem248 T A 5: 130,269,238 (GRCm39) L277H probably damaging Het
Unc13c T A 9: 73,838,757 (GRCm39) H698L probably benign Het
Ushbp1 A G 8: 71,847,799 (GRCm39) V24A possibly damaging Het
Usp24 G T 4: 106,256,309 (GRCm39) probably null Het
Vmn2r50 T G 7: 9,786,970 (GRCm39) I46L probably benign Het
Zfp106 T C 2: 120,365,208 (GRCm39) T423A probably benign Het
Zfp663 T A 2: 165,195,113 (GRCm39) T369S probably benign Het
Zmynd11 T C 13: 9,740,953 (GRCm39) T382A probably damaging Het
Other mutations in Rad51ap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01879:Rad51ap2 APN 12 11,508,139 (GRCm39) missense probably benign 0.10
IGL01908:Rad51ap2 APN 12 11,508,592 (GRCm39) missense probably damaging 1.00
IGL02415:Rad51ap2 APN 12 11,506,930 (GRCm39) missense possibly damaging 0.91
IGL02731:Rad51ap2 APN 12 11,506,897 (GRCm39) missense probably damaging 0.99
IGL03407:Rad51ap2 APN 12 11,507,198 (GRCm39) missense possibly damaging 0.96
R0190:Rad51ap2 UTSW 12 11,508,540 (GRCm39) missense probably benign 0.01
R0281:Rad51ap2 UTSW 12 11,507,043 (GRCm39) missense possibly damaging 0.93
R0564:Rad51ap2 UTSW 12 11,507,897 (GRCm39) missense probably benign 0.20
R0674:Rad51ap2 UTSW 12 11,508,818 (GRCm39) critical splice donor site probably null
R0699:Rad51ap2 UTSW 12 11,507,601 (GRCm39) missense probably benign 0.03
R1033:Rad51ap2 UTSW 12 11,506,252 (GRCm39) missense probably damaging 0.98
R1255:Rad51ap2 UTSW 12 11,508,095 (GRCm39) missense possibly damaging 0.54
R1572:Rad51ap2 UTSW 12 11,507,113 (GRCm39) missense probably damaging 0.99
R1746:Rad51ap2 UTSW 12 11,507,776 (GRCm39) missense probably benign
R1882:Rad51ap2 UTSW 12 11,506,251 (GRCm39) missense possibly damaging 0.85
R2038:Rad51ap2 UTSW 12 11,507,025 (GRCm39) missense possibly damaging 0.73
R2151:Rad51ap2 UTSW 12 11,507,986 (GRCm39) missense probably benign 0.02
R2152:Rad51ap2 UTSW 12 11,507,986 (GRCm39) missense probably benign 0.02
R2154:Rad51ap2 UTSW 12 11,507,986 (GRCm39) missense probably benign 0.02
R2159:Rad51ap2 UTSW 12 11,507,752 (GRCm39) missense possibly damaging 0.87
R2321:Rad51ap2 UTSW 12 11,507,058 (GRCm39) missense probably damaging 1.00
R2355:Rad51ap2 UTSW 12 11,507,109 (GRCm39) missense probably benign
R2393:Rad51ap2 UTSW 12 11,507,798 (GRCm39) missense probably damaging 0.98
R2407:Rad51ap2 UTSW 12 11,508,502 (GRCm39) missense probably damaging 0.99
R2518:Rad51ap2 UTSW 12 11,507,068 (GRCm39) missense probably damaging 0.99
R2929:Rad51ap2 UTSW 12 11,507,185 (GRCm39) missense probably benign 0.07
R3085:Rad51ap2 UTSW 12 11,506,758 (GRCm39) missense possibly damaging 0.53
R4009:Rad51ap2 UTSW 12 11,507,052 (GRCm39) missense probably benign 0.33
R4108:Rad51ap2 UTSW 12 11,508,396 (GRCm39) missense probably damaging 1.00
R4282:Rad51ap2 UTSW 12 11,506,465 (GRCm39) missense probably benign 0.01
R4536:Rad51ap2 UTSW 12 11,507,850 (GRCm39) missense possibly damaging 0.90
R4594:Rad51ap2 UTSW 12 11,507,881 (GRCm39) missense probably benign 0.01
R4678:Rad51ap2 UTSW 12 11,506,552 (GRCm39) missense probably damaging 0.96
R4679:Rad51ap2 UTSW 12 11,506,552 (GRCm39) missense probably damaging 0.96
R4810:Rad51ap2 UTSW 12 11,507,406 (GRCm39) missense probably damaging 1.00
R5421:Rad51ap2 UTSW 12 11,509,368 (GRCm39) nonsense probably null
R5517:Rad51ap2 UTSW 12 11,508,313 (GRCm39) missense probably benign 0.19
R5786:Rad51ap2 UTSW 12 11,506,921 (GRCm39) missense probably damaging 1.00
R5884:Rad51ap2 UTSW 12 11,507,534 (GRCm39) small deletion probably benign
R5932:Rad51ap2 UTSW 12 11,508,387 (GRCm39) missense probably damaging 1.00
R6022:Rad51ap2 UTSW 12 11,508,523 (GRCm39) missense probably damaging 1.00
R6064:Rad51ap2 UTSW 12 11,507,418 (GRCm39) missense possibly damaging 0.80
R6112:Rad51ap2 UTSW 12 11,507,290 (GRCm39) missense probably benign 0.01
R6235:Rad51ap2 UTSW 12 11,507,517 (GRCm39) missense possibly damaging 0.70
R6282:Rad51ap2 UTSW 12 11,507,560 (GRCm39) missense probably benign 0.12
R6488:Rad51ap2 UTSW 12 11,508,161 (GRCm39) missense possibly damaging 0.56
R6668:Rad51ap2 UTSW 12 11,507,647 (GRCm39) missense probably benign 0.17
R6759:Rad51ap2 UTSW 12 11,507,145 (GRCm39) missense possibly damaging 0.91
R7030:Rad51ap2 UTSW 12 11,507,432 (GRCm39) missense possibly damaging 0.93
R7080:Rad51ap2 UTSW 12 11,506,366 (GRCm39) missense probably benign
R7105:Rad51ap2 UTSW 12 11,508,278 (GRCm39) missense possibly damaging 0.84
R7269:Rad51ap2 UTSW 12 11,506,807 (GRCm39) missense possibly damaging 0.67
R7286:Rad51ap2 UTSW 12 11,507,692 (GRCm39) missense probably benign 0.19
R7305:Rad51ap2 UTSW 12 11,507,344 (GRCm39) missense possibly damaging 0.68
R7451:Rad51ap2 UTSW 12 11,507,982 (GRCm39) missense probably benign 0.05
R7632:Rad51ap2 UTSW 12 11,507,116 (GRCm39) missense possibly damaging 0.85
R7833:Rad51ap2 UTSW 12 11,506,656 (GRCm39) missense probably benign
R7839:Rad51ap2 UTSW 12 11,507,238 (GRCm39) missense possibly damaging 0.83
R7953:Rad51ap2 UTSW 12 11,512,593 (GRCm39) nonsense probably null
R8040:Rad51ap2 UTSW 12 11,508,792 (GRCm39) missense probably benign 0.03
R8879:Rad51ap2 UTSW 12 11,507,401 (GRCm39) missense possibly damaging 0.55
R8963:Rad51ap2 UTSW 12 11,506,255 (GRCm39) missense possibly damaging 0.91
R9010:Rad51ap2 UTSW 12 11,508,675 (GRCm39) missense probably benign 0.01
R9328:Rad51ap2 UTSW 12 11,507,772 (GRCm39) missense probably benign 0.03
R9691:Rad51ap2 UTSW 12 11,509,413 (GRCm39) missense possibly damaging 0.70
R9712:Rad51ap2 UTSW 12 11,507,593 (GRCm39) missense possibly damaging 0.95
RF023:Rad51ap2 UTSW 12 11,508,076 (GRCm39) missense possibly damaging 0.94
X0026:Rad51ap2 UTSW 12 11,508,097 (GRCm39) missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TCAAAACTTGGACTGTGACAGATC -3'
(R):5'- GGCACATCTTGTACTCTCATAACTAG -3'

Sequencing Primer
(F):5'- ACTTGGACTGTGACAGATCTATTTTG -3'
(R):5'- CCCATTAAAGGGGGAACATT -3'
Posted On 2016-06-21