Incidental Mutation 'R5151:Dock9'
ID 395395
Institutional Source Beutler Lab
Gene Symbol Dock9
Ensembl Gene ENSMUSG00000025558
Gene Name dedicator of cytokinesis 9
Synonyms D14Wsu89e, B230309H04Rik, Zizimin1
MMRRC Submission 042733-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5151 (G1)
Quality Score 167
Status Not validated
Chromosome 14
Chromosomal Location 121779458-122035249 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 121815582 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 1666 (Y1666H)
Ref Sequence ENSEMBL: ENSMUSP00000148834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040700] [ENSMUST00000100299] [ENSMUST00000212181] [ENSMUST00000212376] [ENSMUST00000212416]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000040700
AA Change: Y1665H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047881
Gene: ENSMUSG00000025558
AA Change: Y1665H

DomainStartEndE-ValueType
Pfam:DUF3398 58 151 5.6e-36 PFAM
PH 172 280 1.38e-16 SMART
Blast:PH 297 372 4e-25 BLAST
Pfam:DOCK-C2 631 822 5.3e-51 PFAM
Pfam:DHR-2 1523 2068 2.1e-212 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100299
AA Change: Y1636H

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097872
Gene: ENSMUSG00000025558
AA Change: Y1636H

DomainStartEndE-ValueType
Pfam:DUF3398 58 153 1.5e-32 PFAM
PH 174 282 1.38e-16 SMART
Blast:PH 299 374 4e-25 BLAST
Pfam:DOCK-C2 632 825 1.3e-59 PFAM
low complexity region 1752 1763 N/A INTRINSIC
Pfam:Ded_cyto 1836 2013 2.4e-69 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211803
Predicted Effect probably damaging
Transcript: ENSMUST00000212181
AA Change: Y1666H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212371
Predicted Effect probably damaging
Transcript: ENSMUST00000212376
AA Change: Y1656H

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000212416
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212719
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1b T A 15: 101,108,651 (GRCm39) C476S probably damaging Het
Agpat2 A G 2: 26,487,218 (GRCm39) M120T probably damaging Het
Ahnak A G 19: 8,994,933 (GRCm39) T5406A probably benign Het
Ano4 A G 10: 88,948,775 (GRCm39) F112L probably damaging Het
Arhgef11 T A 3: 87,642,667 (GRCm39) V1371D probably damaging Het
Ascc3 A G 10: 50,514,059 (GRCm39) N286S probably damaging Het
Ate1 T C 7: 130,109,394 (GRCm39) K202E possibly damaging Het
Cacna1d T C 14: 29,845,280 (GRCm39) T630A probably damaging Het
Ccdc187 G T 2: 26,183,451 (GRCm39) T183N probably damaging Het
Cdk12 C T 11: 98,140,749 (GRCm39) probably benign Het
Ciita A G 16: 10,341,594 (GRCm39) N978S probably damaging Het
Cit A T 5: 116,117,894 (GRCm39) Q1268L probably damaging Het
Csf2rb C T 15: 78,224,781 (GRCm39) R180W probably damaging Het
Dnah17 T C 11: 117,918,293 (GRCm39) I4079V probably damaging Het
Dnah7a A G 1: 53,659,929 (GRCm39) V693A probably benign Het
Dnah8 T A 17: 30,931,269 (GRCm39) V1428E probably benign Het
Dnhd1 C A 7: 105,362,647 (GRCm39) Q3777K probably benign Het
Dpysl3 C T 18: 43,571,145 (GRCm39) G43D probably benign Het
Eftud2 A G 11: 102,758,670 (GRCm39) probably null Het
Erich4 T C 7: 25,315,292 (GRCm39) probably benign Het
Fah T A 7: 84,250,259 (GRCm39) D99V possibly damaging Het
Fat1 T C 8: 45,404,851 (GRCm39) V534A possibly damaging Het
Fgf21 G C 7: 45,263,456 (GRCm39) S207R probably damaging Het
Fras1 C T 5: 96,792,969 (GRCm39) P967S probably damaging Het
H2-T23 T C 17: 36,343,230 (GRCm39) D49G probably damaging Het
Hmcn2 A G 2: 31,279,455 (GRCm39) N1819S probably null Het
Hoxc12 A G 15: 102,846,881 (GRCm39) I258V probably damaging Het
Ighv1-22 T A 12: 114,709,928 (GRCm39) T106S probably damaging Het
Inpp5j T C 11: 3,452,270 (GRCm39) T327A probably damaging Het
Iqgap3 G T 3: 88,025,067 (GRCm39) M689I possibly damaging Het
Itga7 G A 10: 128,780,380 (GRCm39) G559S possibly damaging Het
Kcnq1 G T 7: 142,979,749 (GRCm39) V632L probably benign Het
Lsamp T C 16: 41,954,792 (GRCm39) V230A probably damaging Het
Mfn2 A T 4: 147,970,785 (GRCm39) S305T probably benign Het
Myom3 A G 4: 135,516,883 (GRCm39) T818A probably benign Het
Nacc2 G A 2: 25,980,365 (GRCm39) R24C probably damaging Het
Ntrk3 A C 7: 77,897,048 (GRCm39) I663R probably damaging Het
Nyap1 A G 5: 137,734,376 (GRCm39) V219A probably damaging Het
Obox3 A T 7: 15,360,173 (GRCm39) N165K probably damaging Het
Or13a1 T A 6: 116,470,765 (GRCm39) L65* probably null Het
Or13j1 A T 4: 43,706,518 (GRCm39) F17I probably damaging Het
Or2y12 A G 11: 49,426,242 (GRCm39) T77A possibly damaging Het
Or52e2 C A 7: 102,804,593 (GRCm39) M120I probably damaging Het
Or55b4 G A 7: 102,134,192 (GRCm39) T45I probably benign Het
Pask A T 1: 93,262,350 (GRCm39) L170H probably damaging Het
Piezo2 A T 18: 63,163,480 (GRCm39) I2146N possibly damaging Het
Pitpnm2 A T 5: 124,274,449 (GRCm39) M220K probably damaging Het
Pkhd1l1 A G 15: 44,368,705 (GRCm39) D841G probably benign Het
Pla2g3 C T 11: 3,440,827 (GRCm39) T264M probably benign Het
Plcb1 A T 2: 135,104,165 (GRCm39) Y278F probably benign Het
Prkdc T C 16: 15,533,899 (GRCm39) L1579P probably damaging Het
Rad51ap2 T A 12: 11,507,516 (GRCm39) N479K probably benign Het
Rasgrf2 T C 13: 92,044,155 (GRCm39) H966R probably damaging Het
Rbm27 A G 18: 42,471,509 (GRCm39) D996G probably damaging Het
Rif1 A C 2: 52,010,321 (GRCm39) K2337T probably damaging Het
Rpl13a G T 7: 44,775,385 (GRCm39) N442K probably benign Het
Serpini2 T A 3: 75,153,820 (GRCm39) T380S possibly damaging Het
Setbp1 A T 18: 78,901,214 (GRCm39) W818R probably damaging Het
Siae T A 9: 37,542,869 (GRCm39) C185S probably benign Het
Slc15a2 A G 16: 36,572,659 (GRCm39) V674A probably damaging Het
Slc40a1 A T 1: 45,950,516 (GRCm39) M312K possibly damaging Het
Slc46a3 A G 5: 147,823,566 (GRCm39) L92S probably damaging Het
Son T C 16: 91,452,587 (GRCm39) S445P probably damaging Het
Syne2 T C 12: 76,090,484 (GRCm39) F351L probably benign Het
Tmed3 G A 9: 89,581,825 (GRCm39) R213* probably null Het
Tmem248 T A 5: 130,269,238 (GRCm39) L277H probably damaging Het
Unc13c T A 9: 73,838,757 (GRCm39) H698L probably benign Het
Ushbp1 A G 8: 71,847,799 (GRCm39) V24A possibly damaging Het
Usp24 G T 4: 106,256,309 (GRCm39) probably null Het
Vmn2r50 T G 7: 9,786,970 (GRCm39) I46L probably benign Het
Zfp106 T C 2: 120,365,208 (GRCm39) T423A probably benign Het
Zfp663 T A 2: 165,195,113 (GRCm39) T369S probably benign Het
Zmynd11 T C 13: 9,740,953 (GRCm39) T382A probably damaging Het
Other mutations in Dock9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Dock9 APN 14 121,905,880 (GRCm39) missense probably benign 0.12
IGL00817:Dock9 APN 14 121,935,703 (GRCm39) missense probably damaging 0.96
IGL00923:Dock9 APN 14 121,844,504 (GRCm39) unclassified probably benign
IGL01385:Dock9 APN 14 121,817,995 (GRCm39) missense possibly damaging 0.94
IGL01567:Dock9 APN 14 121,890,496 (GRCm39) missense probably damaging 1.00
IGL01767:Dock9 APN 14 121,860,282 (GRCm39) missense possibly damaging 0.91
IGL01811:Dock9 APN 14 121,796,440 (GRCm39) missense probably damaging 1.00
IGL02512:Dock9 APN 14 121,856,950 (GRCm39) splice site probably benign
IGL02525:Dock9 APN 14 121,877,538 (GRCm39) missense probably damaging 1.00
IGL02550:Dock9 APN 14 121,935,724 (GRCm39) start codon destroyed probably null 0.07
IGL02559:Dock9 APN 14 121,862,559 (GRCm39) splice site probably benign
IGL02666:Dock9 APN 14 121,818,111 (GRCm39) missense probably benign 0.42
IGL02674:Dock9 APN 14 121,833,023 (GRCm39) splice site probably null
IGL02795:Dock9 APN 14 121,877,390 (GRCm39) missense probably benign 0.04
IGL03074:Dock9 APN 14 121,844,682 (GRCm39) missense possibly damaging 0.95
IGL03095:Dock9 APN 14 121,876,940 (GRCm39) missense probably damaging 1.00
IGL03294:Dock9 APN 14 121,879,035 (GRCm39) splice site probably benign
R0036:Dock9 UTSW 14 121,860,265 (GRCm39) missense probably damaging 1.00
R0050:Dock9 UTSW 14 121,844,637 (GRCm39) missense probably benign 0.43
R0050:Dock9 UTSW 14 121,844,637 (GRCm39) missense probably benign 0.43
R0164:Dock9 UTSW 14 121,835,077 (GRCm39) missense probably damaging 1.00
R0164:Dock9 UTSW 14 121,835,077 (GRCm39) missense probably damaging 1.00
R0270:Dock9 UTSW 14 121,813,411 (GRCm39) missense probably benign 0.02
R0494:Dock9 UTSW 14 121,899,996 (GRCm39) missense possibly damaging 0.64
R0726:Dock9 UTSW 14 121,889,180 (GRCm39) nonsense probably null
R1029:Dock9 UTSW 14 121,837,096 (GRCm39) splice site probably null
R1214:Dock9 UTSW 14 121,823,728 (GRCm39) missense probably benign 0.02
R1231:Dock9 UTSW 14 121,813,362 (GRCm39) missense possibly damaging 0.61
R1535:Dock9 UTSW 14 121,783,476 (GRCm39) missense probably damaging 1.00
R1629:Dock9 UTSW 14 121,780,986 (GRCm39) missense possibly damaging 0.88
R1637:Dock9 UTSW 14 121,889,187 (GRCm39) missense possibly damaging 0.66
R1733:Dock9 UTSW 14 121,864,292 (GRCm39) missense probably benign 0.01
R1772:Dock9 UTSW 14 121,847,210 (GRCm39) missense probably benign 0.07
R1855:Dock9 UTSW 14 121,877,571 (GRCm39) missense probably damaging 1.00
R1888:Dock9 UTSW 14 121,862,617 (GRCm39) missense probably benign 0.18
R1888:Dock9 UTSW 14 121,862,617 (GRCm39) missense probably benign 0.18
R1901:Dock9 UTSW 14 121,862,565 (GRCm39) splice site probably null
R1920:Dock9 UTSW 14 121,820,792 (GRCm39) missense probably damaging 1.00
R1987:Dock9 UTSW 14 121,829,242 (GRCm39) missense probably benign 0.00
R3035:Dock9 UTSW 14 121,844,249 (GRCm39) missense possibly damaging 0.60
R3851:Dock9 UTSW 14 121,866,498 (GRCm39) splice site probably null
R4020:Dock9 UTSW 14 121,844,267 (GRCm39) missense probably benign 0.00
R4021:Dock9 UTSW 14 121,864,324 (GRCm39) missense possibly damaging 0.80
R4089:Dock9 UTSW 14 121,820,883 (GRCm39) missense probably damaging 1.00
R4258:Dock9 UTSW 14 121,818,854 (GRCm39) missense probably benign 0.00
R4423:Dock9 UTSW 14 121,799,465 (GRCm39) critical splice donor site probably null
R4561:Dock9 UTSW 14 121,796,419 (GRCm39) missense probably benign 0.01
R4604:Dock9 UTSW 14 121,905,871 (GRCm39) missense probably damaging 1.00
R4646:Dock9 UTSW 14 121,823,658 (GRCm39) missense probably damaging 1.00
R4647:Dock9 UTSW 14 121,823,658 (GRCm39) missense probably damaging 1.00
R4776:Dock9 UTSW 14 121,847,509 (GRCm39) missense possibly damaging 0.81
R4809:Dock9 UTSW 14 121,784,008 (GRCm39) missense probably benign 0.37
R4865:Dock9 UTSW 14 121,780,917 (GRCm39) makesense probably null
R4951:Dock9 UTSW 14 121,890,547 (GRCm39) missense probably benign 0.35
R5359:Dock9 UTSW 14 121,890,472 (GRCm39) missense possibly damaging 0.69
R5366:Dock9 UTSW 14 121,815,615 (GRCm39) missense probably damaging 1.00
R5502:Dock9 UTSW 14 121,847,594 (GRCm39) splice site probably null
R5579:Dock9 UTSW 14 121,837,107 (GRCm39) missense probably damaging 1.00
R5753:Dock9 UTSW 14 121,872,037 (GRCm39) missense probably benign 0.05
R5836:Dock9 UTSW 14 121,918,763 (GRCm39) missense probably damaging 1.00
R5858:Dock9 UTSW 14 121,866,204 (GRCm39) missense probably benign 0.00
R5890:Dock9 UTSW 14 121,905,820 (GRCm39) critical splice donor site probably null
R6075:Dock9 UTSW 14 121,783,385 (GRCm39) missense probably benign
R6298:Dock9 UTSW 14 121,872,006 (GRCm39) missense probably damaging 1.00
R6306:Dock9 UTSW 14 121,799,492 (GRCm39) missense probably damaging 1.00
R6321:Dock9 UTSW 14 121,783,433 (GRCm39) missense probably damaging 1.00
R6330:Dock9 UTSW 14 121,842,655 (GRCm39) start codon destroyed probably null 0.00
R6719:Dock9 UTSW 14 121,847,439 (GRCm39) missense probably damaging 1.00
R6784:Dock9 UTSW 14 121,780,926 (GRCm39) missense probably damaging 1.00
R6826:Dock9 UTSW 14 121,860,330 (GRCm39) missense probably damaging 1.00
R6830:Dock9 UTSW 14 121,860,330 (GRCm39) missense probably damaging 1.00
R6838:Dock9 UTSW 14 121,784,008 (GRCm39) missense possibly damaging 0.71
R6868:Dock9 UTSW 14 121,823,676 (GRCm39) missense probably benign 0.37
R6919:Dock9 UTSW 14 121,880,564 (GRCm39) missense probably benign 0.42
R6989:Dock9 UTSW 14 121,864,791 (GRCm39) missense probably damaging 1.00
R7539:Dock9 UTSW 14 121,818,848 (GRCm39) missense probably damaging 1.00
R7645:Dock9 UTSW 14 121,835,075 (GRCm39) missense probably benign 0.44
R7875:Dock9 UTSW 14 121,863,396 (GRCm39) nonsense probably null
R7900:Dock9 UTSW 14 121,783,491 (GRCm39) missense possibly damaging 0.84
R8040:Dock9 UTSW 14 121,889,206 (GRCm39) missense probably benign 0.06
R8420:Dock9 UTSW 14 121,783,454 (GRCm39) missense probably damaging 1.00
R8511:Dock9 UTSW 14 121,918,847 (GRCm39) missense probably damaging 1.00
R8511:Dock9 UTSW 14 121,864,801 (GRCm39) missense probably benign 0.40
R8514:Dock9 UTSW 14 121,896,199 (GRCm39) missense probably benign 0.25
R8691:Dock9 UTSW 14 121,877,517 (GRCm39) missense possibly damaging 0.49
R8804:Dock9 UTSW 14 121,842,595 (GRCm39) missense probably damaging 0.98
R8894:Dock9 UTSW 14 121,860,373 (GRCm39) missense probably benign 0.10
R8900:Dock9 UTSW 14 121,817,940 (GRCm39) missense probably damaging 1.00
R9069:Dock9 UTSW 14 121,866,324 (GRCm39) missense probably damaging 0.98
R9218:Dock9 UTSW 14 121,905,871 (GRCm39) missense probably damaging 1.00
R9233:Dock9 UTSW 14 121,820,781 (GRCm39) missense probably benign 0.09
R9236:Dock9 UTSW 14 121,876,970 (GRCm39) missense probably damaging 1.00
R9285:Dock9 UTSW 14 121,833,012 (GRCm39) missense probably benign
R9451:Dock9 UTSW 14 121,787,601 (GRCm39) splice site probably benign
R9461:Dock9 UTSW 14 121,842,601 (GRCm39) missense probably benign 0.05
R9484:Dock9 UTSW 14 121,818,844 (GRCm39) missense probably damaging 1.00
R9517:Dock9 UTSW 14 121,829,236 (GRCm39) missense probably benign 0.07
R9542:Dock9 UTSW 14 121,864,775 (GRCm39) missense probably damaging 1.00
R9694:Dock9 UTSW 14 121,818,791 (GRCm39) missense probably damaging 1.00
R9701:Dock9 UTSW 14 121,876,983 (GRCm39) missense probably benign 0.01
R9703:Dock9 UTSW 14 121,781,989 (GRCm39) makesense probably null
R9726:Dock9 UTSW 14 121,835,149 (GRCm39) missense possibly damaging 0.61
R9741:Dock9 UTSW 14 121,877,516 (GRCm39) missense probably damaging 1.00
Z1088:Dock9 UTSW 14 121,792,687 (GRCm39) missense probably damaging 1.00
Z1176:Dock9 UTSW 14 121,889,194 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGCTAGGACGACATGCCATC -3'
(R):5'- GCCTTTTGCGCTAAGATACAGC -3'

Sequencing Primer
(F):5'- ATCCTCTCCATAACACGGGTG -3'
(R):5'- TTGCGCTAAGATACAGCAGTTG -3'
Posted On 2016-06-21