Mutagenetix > Incidental Mutation

Incidental Mutation 'R5151:Csf2rb'

395396

Institutional Source

Beutler Lab

Gene Symbol

Csf2rb

Ensembl Gene

ENSMUSG00000071713

Gene Name

colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)

Synonyms

Csf2rb1, AIC2B, Il5rb, Bc, Il3rb1, beta c, Il3r, common beta chain, CDw131

MMRRC Submission

042733-MU

Accession Numbers

Genbank: NM_007780; MGI: 1339759

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5151 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

78325752-78353847 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 78340581 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Tryptophan at position 180 (R180W)

Ref Sequence

ENSEMBL: ENSMUSP00000154836 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096355] [ENSMUST00000229034] [ENSMUST00000229678] [ENSMUST00000230264] [ENSMUST00000231888]

AlphaFold

P26955

Predicted Effect

probably damaging
Transcript: ENSMUST00000096355
AA Change: R180W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000094082
Gene: ENSMUSG00000071713
AA Change: R180W

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
SCOP:d1gh7a1	29	130	6e-58	SMART
FN3	136	224	4.44e0	SMART
Blast:FN3	245	338	3e-24	BLAST
SCOP:d1gh7a3	245	338	2e-45	SMART
FN3	343	426	2.41e0	SMART
transmembrane domain	446	468	N/A	INTRINSIC
low complexity region	716	743	N/A	INTRINSIC
low complexity region	824	845	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000229034

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229657

Predicted Effect

probably damaging
Transcript: ENSMUST00000229678
AA Change: R180W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229920

Predicted Effect

probably damaging
Transcript: ENSMUST00000230264
AA Change: R180W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000231888

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.6%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygotes for targeted null mutations exhibit lung pathology including lymphocytic infiltration, alveolar proteinosis-like areas, and increased saturated phosphatidylcholine pool sizes. Mutants also have low peripheral eosinophil numbers. [provided by MGI curators]

Allele List at MGI

All alleles(7) : Targeted, knock-out(3) Targeted, other(4)

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acvr1b	T	A	15: 101,210,770	C476S	probably damaging	Het
Agpat2	A	G	2: 26,597,206	M120T	probably damaging	Het
Ahnak	A	G	19: 9,017,569	T5406A	probably benign	Het
Ano4	A	G	10: 89,112,913	F112L	probably damaging	Het
Arhgef11	T	A	3: 87,735,360	V1371D	probably damaging	Het
Ascc3	A	G	10: 50,637,963	N286S	probably damaging	Het
Ate1	T	C	7: 130,507,664	K202E	possibly damaging	Het
Cacna1d	T	C	14: 30,123,323	T630A	probably damaging	Het
Ccdc187	G	T	2: 26,293,439	T183N	probably damaging	Het
Cdk12	C	T	11: 98,249,923		probably benign	Het
Ciita	A	G	16: 10,523,730	N978S	probably damaging	Het
Cit	A	T	5: 115,979,835	Q1268L	probably damaging	Het
Dnah17	T	C	11: 118,027,467	I4079V	probably damaging	Het
Dnah7a	A	G	1: 53,620,770	V693A	probably benign	Het
Dnah8	T	A	17: 30,712,295	V1428E	probably benign	Het
Dnhd1	C	A	7: 105,713,440	Q3777K	probably benign	Het
Dock9	A	G	14: 121,578,170	Y1666H	probably damaging	Het
Dpysl3	C	T	18: 43,438,080	G43D	probably benign	Het
Eftud2	A	G	11: 102,867,844		probably null	Het
Erich4	T	C	7: 25,615,867		probably benign	Het
Fah	T	A	7: 84,601,051	D99V	possibly damaging	Het
Fat1	T	C	8: 44,951,814	V534A	possibly damaging	Het
Fgf21	G	C	7: 45,614,032	S207R	probably damaging	Het
Fras1	C	T	5: 96,645,110	P967S	probably damaging	Het
H2-T23	T	C	17: 36,032,338	D49G	probably damaging	Het
Hmcn2	A	G	2: 31,389,443	N1819S	probably null	Het
Hoxc12	A	G	15: 102,938,446	I258V	probably damaging	Het
Ighv1-22	T	A	12: 114,746,308	T106S	probably damaging	Het
Inpp5j	T	C	11: 3,502,270	T327A	probably damaging	Het
Iqgap3	G	T	3: 88,117,760	M689I	possibly damaging	Het
Itga7	G	A	10: 128,944,511	G559S	possibly damaging	Het
Kcnq1	G	T	7: 143,426,012	V632L	probably benign	Het
Lsamp	T	C	16: 42,134,429	V230A	probably damaging	Het
Mfn2	A	T	4: 147,886,328	S305T	probably benign	Het
Myom3	A	G	4: 135,789,572	T818A	probably benign	Het
Nacc2	G	A	2: 26,090,353	R24C	probably damaging	Het
Ntrk3	A	C	7: 78,247,300	I663R	probably damaging	Het
Nyap1	A	G	5: 137,736,114	V219A	probably damaging	Het
Obox3	A	T	7: 15,626,248	N165K	probably damaging	Het
Olfr1382	A	G	11: 49,535,415	T77A	possibly damaging	Het
Olfr211	T	A	6: 116,493,804	L65*	probably null	Het
Olfr544	G	A	7: 102,484,985	T45I	probably benign	Het
Olfr589	C	A	7: 103,155,386	M120I	probably damaging	Het
Olfr71	A	T	4: 43,706,518	F17I	probably damaging	Het
Pask	A	T	1: 93,334,628	L170H	probably damaging	Het
Piezo2	A	T	18: 63,030,409	I2146N	possibly damaging	Het
Pitpnm2	A	T	5: 124,136,386	M220K	probably damaging	Het
Pkhd1l1	A	G	15: 44,505,309	D841G	probably benign	Het
Pla2g3	C	T	11: 3,490,827	T264M	probably benign	Het
Plcb1	A	T	2: 135,262,245	Y278F	probably benign	Het
Prkdc	T	C	16: 15,716,035	L1579P	probably damaging	Het
Rad51ap2	T	A	12: 11,457,515	N479K	probably benign	Het
Rasgrf2	T	C	13: 91,896,036	H966R	probably damaging	Het
Rbm27	A	G	18: 42,338,444	D996G	probably damaging	Het
Rif1	A	C	2: 52,120,309	K2337T	probably damaging	Het
Rpl13a	G	T	7: 45,125,961	N442K	probably benign	Het
Serpini2	T	A	3: 75,246,513	T380S	possibly damaging	Het
Setbp1	A	T	18: 78,857,999	W818R	probably damaging	Het
Siae	T	A	9: 37,631,573	C185S	probably benign	Het
Slc15a2	A	G	16: 36,752,297	V674A	probably damaging	Het
Slc40a1	A	T	1: 45,911,356	M312K	possibly damaging	Het
Slc46a3	A	G	5: 147,886,756	L92S	probably damaging	Het
Son	T	C	16: 91,655,699	S445P	probably damaging	Het
Syne2	T	C	12: 76,043,710	F351L	probably benign	Het
Tmed3	G	A	9: 89,699,772	R213*	probably null	Het
Tmem248	T	A	5: 130,240,397	L277H	probably damaging	Het
Unc13c	T	A	9: 73,931,475	H698L	probably benign	Het
Ushbp1	A	G	8: 71,395,155	V24A	possibly damaging	Het
Usp24	G	T	4: 106,399,112		probably null	Het
Vmn2r50	T	G	7: 10,053,043	I46L	probably benign	Het
Zfp106	T	C	2: 120,534,727	T423A	probably benign	Het
Zfp663	T	A	2: 165,353,193	T369S	probably benign	Het
Zmynd11	T	C	13: 9,690,917	T382A	probably damaging	Het

Other mutations in Csf2rb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00565:Csf2rb	APN	15	78348514	nonsense	probably null
IGL00979:Csf2rb	APN	15	78348104	missense	probably damaging	1.00
IGL01613:Csf2rb	APN	15	78335302	intron	probably benign
IGL01724:Csf2rb	APN	15	78336414	missense	probably damaging	1.00
IGL01942:Csf2rb	APN	15	78340492	missense	probably benign
IGL02479:Csf2rb	APN	15	78341724	nonsense	probably null
3-1:Csf2rb	UTSW	15	78344603	missense	probably damaging	1.00
IGL02802:Csf2rb	UTSW	15	78338903	missense	probably benign	0.00
R0133:Csf2rb	UTSW	15	78339004	unclassified	probably benign
R0179:Csf2rb	UTSW	15	78336372	missense	possibly damaging	0.52
R0487:Csf2rb	UTSW	15	78348331	missense	probably benign	0.00
R1544:Csf2rb	UTSW	15	78340755	missense	probably benign	0.02
R1619:Csf2rb	UTSW	15	78335211	missense	probably damaging	0.99
R1690:Csf2rb	UTSW	15	78348644	missense	probably benign	0.11
R1831:Csf2rb	UTSW	15	78348253	missense	probably benign	0.03
R3970:Csf2rb	UTSW	15	78341467	missense	probably benign
R4922:Csf2rb	UTSW	15	78346467	missense	probably benign	0.02
R5202:Csf2rb	UTSW	15	78349057	missense	possibly damaging	0.51
R5398:Csf2rb	UTSW	15	78348620	missense	probably benign
R5496:Csf2rb	UTSW	15	78340561	missense	probably damaging	1.00
R5786:Csf2rb	UTSW	15	78348955	missense	probably damaging	1.00
R6166:Csf2rb	UTSW	15	78344566	missense	probably damaging	1.00
R6347:Csf2rb	UTSW	15	78345552	missense	probably damaging	0.99
R6350:Csf2rb	UTSW	15	78345552	missense	probably damaging	0.99
R6899:Csf2rb	UTSW	15	78340702	missense	probably benign	0.01
R6984:Csf2rb	UTSW	15	78345519	missense	probably damaging	1.00
R7484:Csf2rb	UTSW	15	78338899	missense	possibly damaging	0.53
R7671:Csf2rb	UTSW	15	78338930	missense	probably damaging	1.00
R7751:Csf2rb	UTSW	15	78341639	missense	probably damaging	1.00
R7781:Csf2rb	UTSW	15	78344571	missense	probably benign	0.00
R7861:Csf2rb	UTSW	15	78349157	missense	probably damaging	1.00
R8135:Csf2rb	UTSW	15	78348119	missense	possibly damaging	0.95
R8154:Csf2rb	UTSW	15	78340442	critical splice acceptor site	probably null
R8299:Csf2rb	UTSW	15	78346469	missense	possibly damaging	0.88
R8315:Csf2rb	UTSW	15	78347381	missense	possibly damaging	0.83
R8926:Csf2rb	UTSW	15	78340549	missense	probably benign
R8948:Csf2rb	UTSW	15	78348320	missense	probably benign	0.05
R8950:Csf2rb	UTSW	15	78348320	missense	probably benign	0.05
R9265:Csf2rb	UTSW	15	78348546	missense	probably benign	0.08
R9510:Csf2rb	UTSW	15	78345560	critical splice donor site	probably null
R9755:Csf2rb	UTSW	15	78348624	nonsense	probably null
X0024:Csf2rb	UTSW	15	78336360	missense	probably damaging	1.00
X0028:Csf2rb	UTSW	15	78349002	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTGCAACCCGATTAACCCTC -3'
(R):5'- GTCTCCCAGACAAGCTTGAACC -3'

Sequencing Primer
(F):5'- AACCCGATTAACCCTCTGCTTC -3'
(R):5'- ACAAGCTTGAACCCGGGGAC -3'

Posted On

2016-06-21