Mutagenetix > Incidental Mutations

Incidental Mutation 'R5151:Setbp1'

395409

Institutional Source

Beutler Lab

Gene Symbol

Setbp1

Ensembl Gene

ENSMUSG00000024548

Gene Name

SET binding protein 1

Synonyms

Seb

MMRRC Submission

042733-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.640) question?

Stock #

R5151 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

78750380-79109391 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 78857999 bp

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 818 (W818R)

Ref Sequence

ENSEMBL: ENSMUSP00000025430 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025430]

Predicted Effect

probably damaging
Transcript: ENSMUST00000025430
AA Change: W818R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000025430
Gene: ENSMUSG00000024548
AA Change: W818R

Domain	Start	End	E-Value	Type
low complexity region	155	165	N/A	INTRINSIC
low complexity region	221	251	N/A	INTRINSIC
low complexity region	278	286	N/A	INTRINSIC
AT_hook	528	540	4.64e-1	SMART
low complexity region	565	571	N/A	INTRINSIC
low complexity region	594	617	N/A	INTRINSIC
low complexity region	878	887	N/A	INTRINSIC
AT_hook	960	972	1.89e-1	SMART
low complexity region	1086	1103	N/A	INTRINSIC
low complexity region	1316	1337	N/A	INTRINSIC
AT_hook	1393	1405	7.27e-1	SMART
low complexity region	1462	1486	N/A	INTRINSIC
low complexity region	1498	1514	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000161465
AA Change: W818R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000124497
Gene: ENSMUSG00000024548
AA Change: W818R

Domain	Start	End	E-Value	Type
low complexity region	46	55	N/A	INTRINSIC
low complexity region	202	212	N/A	INTRINSIC
low complexity region	268	298	N/A	INTRINSIC
low complexity region	325	333	N/A	INTRINSIC
AT_hook	575	587	4.64e-1	SMART
low complexity region	612	618	N/A	INTRINSIC
low complexity region	641	664	N/A	INTRINSIC
low complexity region	925	934	N/A	INTRINSIC
AT_hook	1007	1019	1.89e-1	SMART
low complexity region	1133	1150	N/A	INTRINSIC
low complexity region	1363	1384	N/A	INTRINSIC
AT_hook	1440	1452	7.27e-1	SMART
low complexity region	1509	1533	N/A	INTRINSIC
low complexity region	1545	1561	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a several motifs including a ski homology region and a SET-binding region in addition to three nuclear localization signals. The encoded protein has been shown to bind the SET nuclear oncogene which is involved in DNA replication. Mutations in this gene are associated with Schinzel-Giedion midface retraction syndrome. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acvr1b	T	A	15: 101,210,770	C476S	probably damaging	Het
Agpat2	A	G	2: 26,597,206	M120T	probably damaging	Het
Ahnak	A	G	19: 9,017,569	T5406A	probably benign	Het
Ano4	A	G	10: 89,112,913	F112L	probably damaging	Het
Arhgef11	T	A	3: 87,735,360	V1371D	probably damaging	Het
Ascc3	A	G	10: 50,637,963	N286S	probably damaging	Het
Ate1	T	C	7: 130,507,664	K202E	possibly damaging	Het
Cacna1d	T	C	14: 30,123,323	T630A	probably damaging	Het
Ccdc187	G	T	2: 26,293,439	T183N	probably damaging	Het
Cdk12	C	T	11: 98,249,923		probably benign	Het
Ciita	A	G	16: 10,523,730	N978S	probably damaging	Het
Cit	A	T	5: 115,979,835	Q1268L	probably damaging	Het
Csf2rb	C	T	15: 78,340,581	R180W	probably damaging	Het
Dnah17	T	C	11: 118,027,467	I4079V	probably damaging	Het
Dnah7a	A	G	1: 53,620,770	V693A	probably benign	Het
Dnah8	T	A	17: 30,712,295	V1428E	probably benign	Het
Dnhd1	C	A	7: 105,713,440	Q3777K	probably benign	Het
Dock9	A	G	14: 121,578,170	Y1666H	probably damaging	Het
Dpysl3	C	T	18: 43,438,080	G43D	probably benign	Het
Eftud2	A	G	11: 102,867,844		probably null	Het
Erich4	T	C	7: 25,615,867		probably benign	Het
Fah	T	A	7: 84,601,051	D99V	possibly damaging	Het
Fat1	T	C	8: 44,951,814	V534A	possibly damaging	Het
Fgf21	G	C	7: 45,614,032	S207R	probably damaging	Het
Fras1	C	T	5: 96,645,110	P967S	probably damaging	Het
H2-T23	T	C	17: 36,032,338	D49G	probably damaging	Het
Hmcn2	A	G	2: 31,389,443	N1819S	probably null	Het
Hoxc12	A	G	15: 102,938,446	I258V	probably damaging	Het
Ighv1-22	T	A	12: 114,746,308	T106S	probably damaging	Het
Inpp5j	T	C	11: 3,502,270	T327A	probably damaging	Het
Iqgap3	G	T	3: 88,117,760	M689I	possibly damaging	Het
Itga7	G	A	10: 128,944,511	G559S	possibly damaging	Het
Kcnq1	G	T	7: 143,426,012	V632L	probably benign	Het
Lsamp	T	C	16: 42,134,429	V230A	probably damaging	Het
Mfn2	A	T	4: 147,886,328	S305T	probably benign	Het
Myom3	A	G	4: 135,789,572	T818A	probably benign	Het
Nacc2	G	A	2: 26,090,353	R24C	probably damaging	Het
Ntrk3	A	C	7: 78,247,300	I663R	probably damaging	Het
Nyap1	A	G	5: 137,736,114	V219A	probably damaging	Het
Obox3	A	T	7: 15,626,248	N165K	probably damaging	Het
Olfr1382	A	G	11: 49,535,415	T77A	possibly damaging	Het
Olfr211	T	A	6: 116,493,804	L65*	probably null	Het
Olfr544	G	A	7: 102,484,985	T45I	probably benign	Het
Olfr589	C	A	7: 103,155,386	M120I	probably damaging	Het
Olfr71	A	T	4: 43,706,518	F17I	probably damaging	Het
Pask	A	T	1: 93,334,628	L170H	probably damaging	Het
Piezo2	A	T	18: 63,030,409	I2146N	possibly damaging	Het
Pitpnm2	A	T	5: 124,136,386	M220K	probably damaging	Het
Pkhd1l1	A	G	15: 44,505,309	D841G	probably benign	Het
Pla2g3	C	T	11: 3,490,827	T264M	probably benign	Het
Plcb1	A	T	2: 135,262,245	Y278F	probably benign	Het
Prkdc	T	C	16: 15,716,035	L1579P	probably damaging	Het
Rad51ap2	T	A	12: 11,457,515	N479K	probably benign	Het
Rasgrf2	T	C	13: 91,896,036	H966R	probably damaging	Het
Rbm27	A	G	18: 42,338,444	D996G	probably damaging	Het
Rif1	A	C	2: 52,120,309	K2337T	probably damaging	Het
Rpl13a	G	T	7: 45,125,961	N442K	probably benign	Het
Serpini2	T	A	3: 75,246,513	T380S	possibly damaging	Het
Siae	T	A	9: 37,631,573	C185S	probably benign	Het
Slc15a2	A	G	16: 36,752,297	V674A	probably damaging	Het
Slc40a1	A	T	1: 45,911,356	M312K	possibly damaging	Het
Slc46a3	A	G	5: 147,886,756	L92S	probably damaging	Het
Son	T	C	16: 91,655,699	S445P	probably damaging	Het
Syne2	T	C	12: 76,043,710	F351L	probably benign	Het
Tmed3	G	A	9: 89,699,772	R213*	probably null	Het
Tmem248	T	A	5: 130,240,397	L277H	probably damaging	Het
Unc13c	T	A	9: 73,931,475	H698L	probably benign	Het
Ushbp1	A	G	8: 71,395,155	V24A	possibly damaging	Het
Usp24	G	T	4: 106,399,112		probably null	Het
Vmn2r50	T	G	7: 10,053,043	I46L	probably benign	Het
Zfp106	T	C	2: 120,534,727	T423A	probably benign	Het
Zfp663	T	A	2: 165,353,193	T369S	probably benign	Het
Zmynd11	T	C	13: 9,690,917	T382A	probably damaging	Het

Other mutations in Setbp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00582:Setbp1	APN	18	78755679	nonsense	probably null	0.00
IGL00668:Setbp1	APN	18	78857770	missense	probably damaging	1.00
IGL01628:Setbp1	APN	18	78856777	missense	probably damaging	1.00
IGL02084:Setbp1	APN	18	78857410	missense	probably damaging	1.00
IGL02405:Setbp1	APN	18	78857299	missense	probably damaging	1.00
IGL02427:Setbp1	APN	18	78857473	missense	probably damaging	1.00
IGL02612:Setbp1	APN	18	78755710	missense	probably damaging	1.00
IGL02725:Setbp1	APN	18	78857374	nonsense	probably null
IGL03005:Setbp1	APN	18	78859125	missense	possibly damaging	0.75
IGL03123:Setbp1	APN	18	78857009	missense	probably damaging	1.00
R1083:Setbp1	UTSW	18	78857626	missense	probably damaging	1.00
R1110:Setbp1	UTSW	18	78857860	missense	probably damaging	1.00
R1167:Setbp1	UTSW	18	78857236	missense	possibly damaging	0.85
R1221:Setbp1	UTSW	18	78856583	missense	probably damaging	1.00
R1225:Setbp1	UTSW	18	78858208	missense	probably damaging	0.99
R1327:Setbp1	UTSW	18	78783358	missense	probably benign	0.00
R1481:Setbp1	UTSW	18	78783301	missense	probably benign	0.01
R1482:Setbp1	UTSW	18	79086835	missense	probably damaging	1.00
R1496:Setbp1	UTSW	18	78859912	missense	probably damaging	1.00
R1550:Setbp1	UTSW	18	78858592	missense	probably damaging	1.00
R1708:Setbp1	UTSW	18	78858467	missense	probably damaging	0.99
R1751:Setbp1	UTSW	18	78857398	missense	probably damaging	1.00
R1922:Setbp1	UTSW	18	78858362	missense	possibly damaging	0.75
R1986:Setbp1	UTSW	18	78858544	missense	probably damaging	0.99
R2090:Setbp1	UTSW	18	78856720	missense	probably benign	0.00
R2851:Setbp1	UTSW	18	78923996	missense	probably benign	0.11
R2853:Setbp1	UTSW	18	78923996	missense	probably benign	0.11
R2941:Setbp1	UTSW	18	78858197	missense	probably damaging	1.00
R3151:Setbp1	UTSW	18	78857435	missense	probably damaging	1.00
R3156:Setbp1	UTSW	18	78859303	missense	probably benign	0.00
R3807:Setbp1	UTSW	18	78783322	missense	probably benign	0.01
R4133:Setbp1	UTSW	18	78856991	missense	probably benign	0.05
R4287:Setbp1	UTSW	18	78859061	missense	probably benign	0.03
R4345:Setbp1	UTSW	18	79086579	missense	probably damaging	0.99
R4374:Setbp1	UTSW	18	78859922	missense	probably damaging	0.97
R4377:Setbp1	UTSW	18	78859922	missense	probably damaging	0.97
R4378:Setbp1	UTSW	18	78856618	missense	possibly damaging	0.95
R4379:Setbp1	UTSW	18	79086681	missense	probably damaging	1.00
R4585:Setbp1	UTSW	18	79086949	missense	probably benign	0.00
R4595:Setbp1	UTSW	18	78857516	missense	probably benign	0.00
R4817:Setbp1	UTSW	18	78858800	missense	probably damaging	1.00
R4971:Setbp1	UTSW	18	78858167	missense	probably benign	0.07
R4976:Setbp1	UTSW	18	79086712	missense	probably damaging	1.00
R5017:Setbp1	UTSW	18	78856594	missense	possibly damaging	0.81
R5066:Setbp1	UTSW	18	78857299	missense	probably damaging	1.00
R5133:Setbp1	UTSW	18	78857482	missense	probably damaging	1.00
R5237:Setbp1	UTSW	18	78856975	missense	possibly damaging	0.92
R5480:Setbp1	UTSW	18	78858063	missense	probably damaging	0.99
R5507:Setbp1	UTSW	18	79086712	missense	probably damaging	1.00
R5529:Setbp1	UTSW	18	79086652	missense	probably damaging	0.99
R5622:Setbp1	UTSW	18	78857485	missense	probably damaging	1.00
R5722:Setbp1	UTSW	18	78856645	missense	possibly damaging	0.95
R5806:Setbp1	UTSW	18	78856482	unclassified	probably null
R5940:Setbp1	UTSW	18	78755488	missense	probably damaging	1.00
R6025:Setbp1	UTSW	18	78859240	missense	probably damaging	0.98
R6030:Setbp1	UTSW	18	78857711	missense	probably benign	0.02
R6030:Setbp1	UTSW	18	78857711	missense	probably benign	0.02
R6250:Setbp1	UTSW	18	78858002	missense	probably benign	0.00
R6256:Setbp1	UTSW	18	78857257	missense	probably damaging	1.00
R6332:Setbp1	UTSW	18	78783369	missense	probably benign	0.21
R6522:Setbp1	UTSW	18	78857390	missense	probably damaging	0.98
R6873:Setbp1	UTSW	18	78859559	missense	probably benign	0.00
R6886:Setbp1	UTSW	18	78857500	missense	probably damaging	1.00
R6986:Setbp1	UTSW	18	78857839	missense	probably damaging	1.00
R7042:Setbp1	UTSW	18	79086855	missense	probably damaging	1.00
R7131:Setbp1	UTSW	18	79086960	missense	probably benign	0.08
R7134:Setbp1	UTSW	18	78859519	missense	possibly damaging	0.86
R7215:Setbp1	UTSW	18	78856837	missense	probably damaging	0.97
R7219:Setbp1	UTSW	18	78755745	missense	probably damaging	1.00
R7378:Setbp1	UTSW	18	78857486	missense	probably damaging	1.00
R7461:Setbp1	UTSW	18	78856492	missense	probably benign	0.06
R7589:Setbp1	UTSW	18	78856492	missense	probably benign	0.01
Z1088:Setbp1	UTSW	18	78859594	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CTGGGTTGTCAAGGGAACAG -3'
(R):5'- GGCTTCTTCACCAGCAGCTATG -3'

Sequencing Primer
(F):5'- GTCGAAAGAGTACCTCCGC -3'
(R):5'- TATGCACCCACTCTCAACACAGTTAG -3'

Posted On

2016-06-21