Incidental Mutation 'R5152:Fmo5'
ID395425
Institutional Source Beutler Lab
Gene Symbol Fmo5
Ensembl Gene ENSMUSG00000028088
Gene Nameflavin containing monooxygenase 5
Synonyms
MMRRC Submission 042734-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R5152 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location97628804-97655282 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 97641762 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 242 (Y242C)
Ref Sequence ENSEMBL: ENSMUSP00000102665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029729] [ENSMUST00000107049] [ENSMUST00000107050]
Predicted Effect probably benign
Transcript: ENSMUST00000029729
AA Change: Y242C

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000029729
Gene: ENSMUSG00000028088
AA Change: Y242C

DomainStartEndE-ValueType
Pfam:FMO-like 3 533 9.7e-280 PFAM
Pfam:Pyr_redox_2 5 224 3.4e-8 PFAM
Pfam:Pyr_redox_3 7 221 2.2e-21 PFAM
Pfam:NAD_binding_8 8 69 1.7e-6 PFAM
Pfam:K_oxygenase 81 223 9.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107049
AA Change: Y242C

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000102664
Gene: ENSMUSG00000028088
AA Change: Y242C

DomainStartEndE-ValueType
Pfam:FMO-like 3 533 9.7e-280 PFAM
Pfam:Pyr_redox_2 5 224 3.4e-8 PFAM
Pfam:Pyr_redox_3 7 221 2.2e-21 PFAM
Pfam:NAD_binding_8 8 69 1.7e-6 PFAM
Pfam:K_oxygenase 81 223 9.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107050
AA Change: Y242C

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000102665
Gene: ENSMUSG00000028088
AA Change: Y242C

DomainStartEndE-ValueType
Pfam:FMO-like 3 533 9.7e-280 PFAM
Pfam:Pyr_redox_2 4 228 8.5e-11 PFAM
Pfam:Pyr_redox_3 7 221 4.7e-11 PFAM
Pfam:NAD_binding_8 8 70 3.5e-7 PFAM
Pfam:K_oxygenase 80 222 2.9e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140283
Meta Mutation Damage Score 0.122 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Metabolic N-oxidation of the diet-derived amino-trimethylamine (TMA) is mediated by flavin-containing monooxygenase and is subject to an inherited FMO3 polymorphism in man resulting in a small subpopulation with reduced TMA N-oxidation capacity resulting in fish odor syndrome Trimethylaminuria. Three forms of the enzyme, FMO1 found in fetal liver, FMO2 found in adult liver, and FMO3 are encoded by genes clustered in the 1q23-q25 region. Flavin-containing monooxygenases are NADPH-dependent flavoenzymes that catalyzes the oxidation of soft nucleophilic heteroatom centers in drugs, pesticides, and xenobiotics. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2009]
PHENOTYPE: Mice homozygous for a knock-out allele show an age-related lean phenotype despite increased food intake, lower plasma levels of glucose and cholesterol, decreased fat storage in WAT, altered fatty acid oxidation, increased energy expenditure and respiratory quotient but normal physical activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T C 7: 120,540,623 S1503P probably benign Het
Actn3 C A 19: 4,863,544 V620F probably damaging Het
Adamtsl3 A G 7: 82,574,544 K252E probably benign Het
Adgrg1 A G 8: 95,009,745 Y509C probably damaging Het
Arhgef2 G A 3: 88,629,568 probably null Het
Bod1l T C 5: 41,816,543 E2476G probably benign Het
C130026I21Rik G A 1: 85,261,860 P19S probably benign Het
Capn3 T C 2: 120,501,330 probably benign Het
Catsperz T C 19: 6,923,337 T147A probably benign Het
Cc2d1b C A 4: 108,626,086 A289E probably benign Het
Ccdc170 A C 10: 4,561,107 H722P probably damaging Het
Cdk13 C A 13: 17,718,525 A1358S probably benign Het
Cntn6 T A 6: 104,569,113 probably benign Het
Coch A G 12: 51,595,442 N66D probably benign Het
Col12a1 A G 9: 79,656,748 S1732P probably damaging Het
Copa T A 1: 172,118,061 V917E probably benign Het
Csmd2 C A 4: 128,552,035 N3299K probably benign Het
Cyp2c67 A T 19: 39,638,688 F233I probably benign Het
D630039A03Rik T A 4: 57,910,434 H126L probably damaging Het
Ddx46 T C 13: 55,659,030 L492P probably damaging Het
Dpysl3 C T 18: 43,438,080 G43D probably benign Het
Enpp5 C T 17: 44,081,133 P151L probably damaging Het
Exoc3l4 T C 12: 111,430,893 probably benign Het
Faap100 T A 11: 120,377,632 E105V possibly damaging Het
Flg2 C A 3: 93,214,977 P1485T unknown Het
Fsip2 C A 2: 82,978,572 T1745N probably benign Het
Gata4 T A 14: 63,241,121 N10Y probably damaging Het
Gm10722 A C 9: 3,001,041 Y39S probably benign Het
Gm4787 A C 12: 81,378,677 S236A probably benign Het
Gm9125 T C 3: 94,050,144 probably benign Het
Golga7 A C 8: 23,245,949 S94A probably benign Het
Gpbp1 A G 13: 111,453,281 probably benign Het
Grm1 A G 10: 11,079,875 Y222H probably benign Het
Gstcd A G 3: 133,084,956 Y17H possibly damaging Het
Hephl1 C A 9: 15,080,185 D586Y probably damaging Het
Hpn C A 7: 31,099,836 V35L probably damaging Het
Il23r T A 6: 67,423,741 N535I probably damaging Het
Inpp4a T C 1: 37,358,535 I45T possibly damaging Het
Itgae G C 11: 73,130,995 G901R probably damaging Het
Kif28 T C 1: 179,702,538 D686G probably damaging Het
Kit A G 5: 75,620,847 E312G probably benign Het
Lamb2 C A 9: 108,487,738 S1230R probably benign Het
Lars A T 18: 42,228,777 D588E possibly damaging Het
Lgr4 T A 2: 110,000,603 F292I probably damaging Het
Lmf1 C T 17: 25,655,519 S458L probably damaging Het
Lpin2 T A 17: 71,245,159 C787S probably damaging Het
Ms4a4a A C 19: 11,388,312 I138L probably benign Het
Mterf1a A T 5: 3,890,984 F295I probably damaging Het
Muc4 A T 16: 32,757,058 K241* probably null Het
Muc5b T C 7: 141,865,531 F4017S possibly damaging Het
Nfkbil1 T C 17: 35,221,408 probably benign Het
Olfr1269 A G 2: 90,119,121 L159P probably damaging Het
Olfr935 A T 9: 38,995,177 V86E possibly damaging Het
Olfr976 T C 9: 39,956,906 T22A probably benign Het
Osgep T C 14: 50,917,858 D81G probably damaging Het
Otos A G 1: 92,644,394 F70S probably damaging Het
Pcdhb2 T A 18: 37,296,126 V384D probably damaging Het
Ppp1r10 C T 17: 35,929,252 P514S probably damaging Het
Pramef17 G A 4: 143,994,260 P37L probably damaging Het
Prdm16 A G 4: 154,346,102 Y309H probably damaging Het
Rap1gds1 A T 3: 138,956,201 D382E probably damaging Het
Reln A G 5: 21,948,629 F2226L probably damaging Het
Rmi2 C T 16: 10,839,901 T125M probably damaging Het
Setd1a C T 7: 127,784,025 T231I probably benign Het
Sftpa1 G A 14: 41,134,352 G218D probably damaging Het
Shcbp1 A T 8: 4,736,138 F655I probably damaging Het
Slc5a7 T C 17: 54,278,833 I319V possibly damaging Het
Spata31d1c C T 13: 65,035,595 T317I probably damaging Het
Speg C T 1: 75,428,098 P2845S possibly damaging Het
Synpo2 A G 3: 123,235,901 probably null Het
Tdrd7 T A 4: 46,013,191 S644T probably damaging Het
Tmem182 T A 1: 40,838,300 Y112N probably damaging Het
Usp45 T A 4: 21,824,815 N522K probably benign Het
Vnn3 A T 10: 23,864,339 Y180F probably benign Het
Wnk1 C T 6: 120,002,280 R282Q possibly damaging Het
Xrn1 A T 9: 95,964,065 D57V probably benign Het
Zfp831 T C 2: 174,644,564 V344A probably benign Het
Other mutations in Fmo5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01469:Fmo5 APN 3 97651568 missense probably benign 0.19
IGL01926:Fmo5 APN 3 97637481 missense probably damaging 1.00
IGL03062:Fmo5 APN 3 97635593 missense probably damaging 1.00
IGL03215:Fmo5 APN 3 97641806 missense probably benign
IGL03323:Fmo5 APN 3 97639007 splice site probably null
PIT4445001:Fmo5 UTSW 3 97651528 missense probably benign 0.30
R0133:Fmo5 UTSW 3 97645636 missense probably damaging 0.99
R0207:Fmo5 UTSW 3 97645681 missense probably damaging 1.00
R0570:Fmo5 UTSW 3 97629140 missense probably damaging 1.00
R2014:Fmo5 UTSW 3 97635682 missense possibly damaging 0.56
R2093:Fmo5 UTSW 3 97645878 missense probably benign 0.41
R3087:Fmo5 UTSW 3 97641695 missense probably damaging 1.00
R3694:Fmo5 UTSW 3 97645914 missense probably damaging 1.00
R3764:Fmo5 UTSW 3 97645717 missense probably damaging 1.00
R4864:Fmo5 UTSW 3 97645879 missense probably damaging 1.00
R4987:Fmo5 UTSW 3 97635578 missense probably benign 0.23
R5304:Fmo5 UTSW 3 97651622 missense probably damaging 1.00
R5306:Fmo5 UTSW 3 97641760 missense probably benign 0.00
R5563:Fmo5 UTSW 3 97638891 missense probably damaging 1.00
R5888:Fmo5 UTSW 3 97641725 missense probably benign 0.10
R6352:Fmo5 UTSW 3 97645675 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- AACCTTCAGGAGAATGGGACTG -3'
(R):5'- TGGCTGTTCTGAAAGCCTGG -3'

Sequencing Primer
(F):5'- AATGGGACTGCTTTTGAAGGAC -3'
(R):5'- TCCTGGAAACGTACCTGT -3'
Posted On2016-06-21