Incidental Mutation 'R5152:Csmd2'
ID 395434
Institutional Source Beutler Lab
Gene Symbol Csmd2
Ensembl Gene ENSMUSG00000028804
Gene Name CUB and Sushi multiple domains 2
Synonyms
MMRRC Submission 042734-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.111) question?
Stock # R5152 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 127881650-128461449 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 128445828 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 3299 (N3299K)
Ref Sequence ENSEMBL: ENSMUSP00000138958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000184063]
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139561
Predicted Effect probably benign
Transcript: ENSMUST00000184063
AA Change: N3299K

PolyPhen 2 Score 0.270 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000221199
Meta Mutation Damage Score 0.4845 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 99% (83/84)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T C 7: 120,139,846 (GRCm39) S1503P probably benign Het
Actn3 C A 19: 4,913,572 (GRCm39) V620F probably damaging Het
Adamtsl3 A G 7: 82,223,752 (GRCm39) K252E probably benign Het
Adgrg1 A G 8: 95,736,373 (GRCm39) Y509C probably damaging Het
Arhgef2 G A 3: 88,536,875 (GRCm39) probably null Het
Bod1l T C 5: 41,973,886 (GRCm39) E2476G probably benign Het
Capn3 T C 2: 120,331,811 (GRCm39) probably benign Het
Catsperz T C 19: 6,900,705 (GRCm39) T147A probably benign Het
Cc2d1b C A 4: 108,483,283 (GRCm39) A289E probably benign Het
Ccdc170 A C 10: 4,511,107 (GRCm39) H722P probably damaging Het
Cdk13 C A 13: 17,893,110 (GRCm39) A1358S probably benign Het
Cntn6 T A 6: 104,546,074 (GRCm39) probably benign Het
Coch A G 12: 51,642,225 (GRCm39) N66D probably benign Het
Col12a1 A G 9: 79,564,030 (GRCm39) S1732P probably damaging Het
Copa T A 1: 171,945,628 (GRCm39) V917E probably benign Het
Cyp2c67 A T 19: 39,627,132 (GRCm39) F233I probably benign Het
D630039A03Rik T A 4: 57,910,434 (GRCm39) H126L probably damaging Het
Ddx46 T C 13: 55,806,843 (GRCm39) L492P probably damaging Het
Dpysl3 C T 18: 43,571,145 (GRCm39) G43D probably benign Het
Enpp5 C T 17: 44,392,024 (GRCm39) P151L probably damaging Het
Exoc3l4 T C 12: 111,397,327 (GRCm39) probably benign Het
Faap100 T A 11: 120,268,458 (GRCm39) E105V possibly damaging Het
Flg2 C A 3: 93,122,284 (GRCm39) P1485T unknown Het
Fmo5 A G 3: 97,549,078 (GRCm39) Y242C probably benign Het
Fsip2 C A 2: 82,808,916 (GRCm39) T1745N probably benign Het
Gata4 T A 14: 63,478,570 (GRCm39) N10Y probably damaging Het
Gm10722 A C 9: 3,001,041 (GRCm39) Y39S probably benign Het
Gm4787 A C 12: 81,425,451 (GRCm39) S236A probably benign Het
Golga7 A C 8: 23,735,965 (GRCm39) S94A probably benign Het
Gpbp1 A G 13: 111,589,815 (GRCm39) probably benign Het
Grm1 A G 10: 10,955,619 (GRCm39) Y222H probably benign Het
Gstcd A G 3: 132,790,717 (GRCm39) Y17H possibly damaging Het
Hephl1 C A 9: 14,991,481 (GRCm39) D586Y probably damaging Het
Hpn C A 7: 30,799,261 (GRCm39) V35L probably damaging Het
Il23r T A 6: 67,400,725 (GRCm39) N535I probably damaging Het
Inpp4a T C 1: 37,397,616 (GRCm39) I45T possibly damaging Het
Itgae G C 11: 73,021,821 (GRCm39) G901R probably damaging Het
Kif28 T C 1: 179,530,103 (GRCm39) D686G probably damaging Het
Kit A G 5: 75,781,507 (GRCm39) E312G probably benign Het
Lamb2 C A 9: 108,364,937 (GRCm39) S1230R probably benign Het
Lars1 A T 18: 42,361,842 (GRCm39) D588E possibly damaging Het
Lgr4 T A 2: 109,830,948 (GRCm39) F292I probably damaging Het
Lmf1 C T 17: 25,874,493 (GRCm39) S458L probably damaging Het
Lpin2 T A 17: 71,552,154 (GRCm39) C787S probably damaging Het
Ms4a4a A C 19: 11,365,676 (GRCm39) I138L probably benign Het
Mterf1a A T 5: 3,940,984 (GRCm39) F295I probably damaging Het
Muc4 A T 16: 32,577,432 (GRCm39) K241* probably null Het
Muc5b T C 7: 141,419,268 (GRCm39) F4017S possibly damaging Het
Nfkbil1 T C 17: 35,440,384 (GRCm39) probably benign Het
Or10d5j T C 9: 39,868,202 (GRCm39) T22A probably benign Het
Or4x6 A G 2: 89,949,465 (GRCm39) L159P probably damaging Het
Or8g21 A T 9: 38,906,473 (GRCm39) V86E possibly damaging Het
Osgep T C 14: 51,155,315 (GRCm39) D81G probably damaging Het
Otos A G 1: 92,572,116 (GRCm39) F70S probably damaging Het
Pcdhb2 T A 18: 37,429,179 (GRCm39) V384D probably damaging Het
Ppp1r10 C T 17: 36,240,144 (GRCm39) P514S probably damaging Het
Pramel14 G A 4: 143,720,830 (GRCm39) P37L probably damaging Het
Prdm16 A G 4: 154,430,559 (GRCm39) Y309H probably damaging Het
Rap1gds1 A T 3: 138,661,962 (GRCm39) D382E probably damaging Het
Reln A G 5: 22,153,627 (GRCm39) F2226L probably damaging Het
Rmi2 C T 16: 10,657,765 (GRCm39) T125M probably damaging Het
Setd1a C T 7: 127,383,197 (GRCm39) T231I probably benign Het
Sftpa1 G A 14: 40,856,309 (GRCm39) G218D probably damaging Het
Shcbp1 A T 8: 4,786,138 (GRCm39) F655I probably damaging Het
Slc5a7 T C 17: 54,585,861 (GRCm39) I319V possibly damaging Het
Sp140l2 G A 1: 85,239,581 (GRCm39) P19S probably benign Het
Spata31d1c C T 13: 65,183,409 (GRCm39) T317I probably damaging Het
Speg C T 1: 75,404,742 (GRCm39) P2845S possibly damaging Het
Synpo2 A G 3: 123,029,550 (GRCm39) probably null Het
Tdpoz9 T C 3: 93,957,451 (GRCm39) probably benign Het
Tdrd7 T A 4: 46,013,191 (GRCm39) S644T probably damaging Het
Tmem182 T A 1: 40,877,460 (GRCm39) Y112N probably damaging Het
Usp45 T A 4: 21,824,815 (GRCm39) N522K probably benign Het
Vnn3 A T 10: 23,740,237 (GRCm39) Y180F probably benign Het
Wnk1 C T 6: 119,979,241 (GRCm39) R282Q possibly damaging Het
Xrn1 A T 9: 95,846,118 (GRCm39) D57V probably benign Het
Zfp831 T C 2: 174,486,357 (GRCm39) V344A probably benign Het
Other mutations in Csmd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Csmd2 APN 4 128,377,266 (GRCm39) missense probably benign 0.03
IGL01098:Csmd2 APN 4 127,952,845 (GRCm39) missense probably damaging 0.99
IGL01114:Csmd2 APN 4 128,262,923 (GRCm39) missense probably benign 0.04
IGL01364:Csmd2 APN 4 128,308,081 (GRCm39) missense probably benign 0.01
IGL01530:Csmd2 APN 4 128,308,094 (GRCm39) missense possibly damaging 0.66
IGL01582:Csmd2 APN 4 128,457,098 (GRCm39) nonsense probably null
IGL01670:Csmd2 APN 4 128,407,164 (GRCm39) splice site probably benign
IGL01707:Csmd2 APN 4 128,276,798 (GRCm39) missense possibly damaging 0.81
IGL01810:Csmd2 APN 4 128,374,638 (GRCm39) splice site probably benign
IGL01837:Csmd2 APN 4 128,313,363 (GRCm39) missense possibly damaging 0.92
IGL01924:Csmd2 APN 4 128,453,740 (GRCm39) missense unknown
IGL02013:Csmd2 APN 4 128,215,116 (GRCm39) missense possibly damaging 0.47
IGL02020:Csmd2 APN 4 128,453,672 (GRCm39) missense probably damaging 1.00
IGL02037:Csmd2 APN 4 128,371,263 (GRCm39) splice site probably benign
IGL02303:Csmd2 APN 4 128,262,801 (GRCm39) missense probably benign 0.01
IGL02317:Csmd2 APN 4 128,357,520 (GRCm39) splice site probably benign
IGL02322:Csmd2 APN 4 128,357,520 (GRCm39) splice site probably benign
IGL02338:Csmd2 APN 4 128,288,859 (GRCm39) missense possibly damaging 0.79
IGL02412:Csmd2 APN 4 128,407,165 (GRCm39) splice site probably benign
IGL02428:Csmd2 APN 4 128,368,609 (GRCm39) missense possibly damaging 0.82
IGL02491:Csmd2 APN 4 128,428,050 (GRCm39) missense probably benign
IGL02701:Csmd2 APN 4 128,389,934 (GRCm39) missense probably benign 0.17
IGL02801:Csmd2 APN 4 128,445,868 (GRCm39) splice site probably null
IGL02818:Csmd2 APN 4 128,103,521 (GRCm39) missense probably damaging 1.00
IGL02863:Csmd2 APN 4 128,415,677 (GRCm39) missense probably benign 0.00
IGL02876:Csmd2 APN 4 128,215,128 (GRCm39) nonsense probably null
IGL02977:Csmd2 APN 4 128,387,069 (GRCm39) nonsense probably null
IGL03006:Csmd2 APN 4 128,374,558 (GRCm39) splice site probably benign
IGL03032:Csmd2 APN 4 128,412,834 (GRCm39) missense probably benign 0.03
IGL03148:Csmd2 APN 4 128,278,062 (GRCm39) missense probably damaging 1.00
IGL03157:Csmd2 APN 4 128,308,092 (GRCm39) nonsense probably null
IGL03245:Csmd2 APN 4 128,402,915 (GRCm39) missense probably benign 0.12
IGL03376:Csmd2 APN 4 128,411,464 (GRCm39) missense probably benign 0.03
IGL03014:Csmd2 UTSW 4 128,190,222 (GRCm39) missense probably benign 0.01
R0109:Csmd2 UTSW 4 128,438,536 (GRCm39) missense probably benign 0.03
R0112:Csmd2 UTSW 4 128,389,822 (GRCm39) missense probably damaging 1.00
R0157:Csmd2 UTSW 4 128,415,704 (GRCm39) missense probably benign 0.02
R0390:Csmd2 UTSW 4 128,027,466 (GRCm39) intron probably benign
R0441:Csmd2 UTSW 4 128,414,023 (GRCm39) missense probably benign 0.00
R0519:Csmd2 UTSW 4 128,380,798 (GRCm39) missense possibly damaging 0.95
R0743:Csmd2 UTSW 4 128,007,469 (GRCm39) missense probably benign 0.00
R0746:Csmd2 UTSW 4 128,308,090 (GRCm39) missense probably damaging 1.00
R0973:Csmd2 UTSW 4 128,389,981 (GRCm39) missense possibly damaging 0.91
R1019:Csmd2 UTSW 4 128,415,807 (GRCm39) missense probably benign 0.00
R1476:Csmd2 UTSW 4 128,380,794 (GRCm39) missense probably benign 0.08
R1641:Csmd2 UTSW 4 128,377,188 (GRCm39) missense possibly damaging 0.68
R1709:Csmd2 UTSW 4 128,389,988 (GRCm39) missense probably damaging 0.96
R2866:Csmd2 UTSW 4 128,308,185 (GRCm39) critical splice donor site probably null
R2870:Csmd2 UTSW 4 128,451,511 (GRCm39) missense unknown
R2870:Csmd2 UTSW 4 128,451,511 (GRCm39) missense unknown
R2871:Csmd2 UTSW 4 128,451,511 (GRCm39) missense unknown
R2871:Csmd2 UTSW 4 128,451,511 (GRCm39) missense unknown
R2872:Csmd2 UTSW 4 128,451,511 (GRCm39) missense unknown
R2872:Csmd2 UTSW 4 128,451,511 (GRCm39) missense unknown
R2873:Csmd2 UTSW 4 128,451,511 (GRCm39) missense unknown
R2893:Csmd2 UTSW 4 128,432,786 (GRCm39) splice site probably null
R3796:Csmd2 UTSW 4 128,411,388 (GRCm39) missense probably benign 0.20
R3797:Csmd2 UTSW 4 128,411,388 (GRCm39) missense probably benign 0.20
R3798:Csmd2 UTSW 4 128,411,388 (GRCm39) missense probably benign 0.20
R3914:Csmd2 UTSW 4 128,215,117 (GRCm39) missense probably benign 0.07
R4198:Csmd2 UTSW 4 128,404,717 (GRCm39) missense probably benign 0.07
R4489:Csmd2 UTSW 4 128,275,738 (GRCm39) missense possibly damaging 0.68
R4571:Csmd2 UTSW 4 128,373,888 (GRCm39) splice site probably null
R4581:Csmd2 UTSW 4 128,262,881 (GRCm39) missense probably benign 0.02
R4599:Csmd2 UTSW 4 127,881,921 (GRCm39) missense probably benign 0.35
R4649:Csmd2 UTSW 4 128,439,866 (GRCm39) missense probably benign
R4706:Csmd2 UTSW 4 128,438,544 (GRCm39) missense probably benign
R4776:Csmd2 UTSW 4 128,336,685 (GRCm39) missense probably benign 0.09
R4838:Csmd2 UTSW 4 128,411,542 (GRCm39) missense probably benign
R4900:Csmd2 UTSW 4 128,346,318 (GRCm39) missense probably benign 0.03
R4999:Csmd2 UTSW 4 128,415,723 (GRCm39) missense probably benign 0.00
R5024:Csmd2 UTSW 4 128,215,141 (GRCm39) missense possibly damaging 0.94
R5034:Csmd2 UTSW 4 127,952,901 (GRCm39) missense probably damaging 0.98
R5172:Csmd2 UTSW 4 128,371,190 (GRCm39) missense probably benign 0.10
R5231:Csmd2 UTSW 4 128,439,842 (GRCm39) missense probably benign 0.00
R5279:Csmd2 UTSW 4 128,350,707 (GRCm39) missense probably benign 0.30
R5287:Csmd2 UTSW 4 128,380,677 (GRCm39) missense probably benign 0.01
R5403:Csmd2 UTSW 4 128,380,677 (GRCm39) missense probably benign 0.01
R5410:Csmd2 UTSW 4 128,442,612 (GRCm39) missense probably benign
R5551:Csmd2 UTSW 4 128,404,741 (GRCm39) missense possibly damaging 0.83
R5566:Csmd2 UTSW 4 128,356,682 (GRCm39) critical splice donor site probably null
R5826:Csmd2 UTSW 4 128,412,992 (GRCm39) splice site probably null
R5907:Csmd2 UTSW 4 128,091,178 (GRCm39) missense probably damaging 0.99
R5913:Csmd2 UTSW 4 128,445,781 (GRCm39) missense probably benign 0.01
R5970:Csmd2 UTSW 4 128,439,944 (GRCm39) missense probably benign 0.00
R5977:Csmd2 UTSW 4 127,952,827 (GRCm39) missense probably damaging 1.00
R6027:Csmd2 UTSW 4 128,453,739 (GRCm39) missense unknown
R6075:Csmd2 UTSW 4 128,380,658 (GRCm39) missense probably benign 0.15
R6129:Csmd2 UTSW 4 128,387,127 (GRCm39) missense possibly damaging 0.79
R6363:Csmd2 UTSW 4 128,294,172 (GRCm39) missense probably benign 0.00
R6366:Csmd2 UTSW 4 128,377,245 (GRCm39) missense probably benign 0.00
R6404:Csmd2 UTSW 4 128,415,743 (GRCm39) missense possibly damaging 0.90
R6437:Csmd2 UTSW 4 127,881,893 (GRCm39) missense probably benign 0.24
R6441:Csmd2 UTSW 4 128,288,757 (GRCm39) missense probably benign 0.03
R6643:Csmd2 UTSW 4 128,266,390 (GRCm39) missense probably benign 0.14
R6724:Csmd2 UTSW 4 128,457,164 (GRCm39) missense probably damaging 0.97
R6734:Csmd2 UTSW 4 128,357,606 (GRCm39) missense probably benign 0.00
R6750:Csmd2 UTSW 4 128,091,018 (GRCm39) missense possibly damaging 0.91
R6801:Csmd2 UTSW 4 128,277,743 (GRCm39) missense probably benign 0.11
R6842:Csmd2 UTSW 4 128,402,952 (GRCm39) missense possibly damaging 0.72
R6843:Csmd2 UTSW 4 128,357,587 (GRCm39) missense probably benign 0.27
R6868:Csmd2 UTSW 4 128,336,633 (GRCm39) missense probably benign
R6882:Csmd2 UTSW 4 128,343,062 (GRCm39) missense probably benign 0.01
R7019:Csmd2 UTSW 4 128,262,856 (GRCm39) missense
R7028:Csmd2 UTSW 4 128,171,021 (GRCm39) missense
R7096:Csmd2 UTSW 4 128,356,519 (GRCm39) missense
R7122:Csmd2 UTSW 4 128,343,020 (GRCm39) missense
R7125:Csmd2 UTSW 4 128,389,955 (GRCm39) missense
R7197:Csmd2 UTSW 4 128,404,826 (GRCm39) missense
R7234:Csmd2 UTSW 4 128,350,572 (GRCm39) missense
R7299:Csmd2 UTSW 4 128,422,055 (GRCm39) missense
R7301:Csmd2 UTSW 4 128,422,055 (GRCm39) missense
R7319:Csmd2 UTSW 4 128,287,472 (GRCm39) missense
R7331:Csmd2 UTSW 4 128,458,021 (GRCm39) splice site probably null
R7332:Csmd2 UTSW 4 128,313,360 (GRCm39) missense
R7352:Csmd2 UTSW 4 128,451,429 (GRCm39) missense
R7402:Csmd2 UTSW 4 128,215,889 (GRCm39) missense
R7402:Csmd2 UTSW 4 128,215,888 (GRCm39) missense
R7474:Csmd2 UTSW 4 128,439,920 (GRCm39) missense
R7555:Csmd2 UTSW 4 128,346,251 (GRCm39) missense
R7592:Csmd2 UTSW 4 128,357,591 (GRCm39) missense
R7700:Csmd2 UTSW 4 128,439,549 (GRCm39) splice site probably null
R7714:Csmd2 UTSW 4 128,276,743 (GRCm39) nonsense probably null
R7734:Csmd2 UTSW 4 128,445,850 (GRCm39) missense
R7735:Csmd2 UTSW 4 128,350,723 (GRCm39) critical splice donor site probably null
R7757:Csmd2 UTSW 4 128,377,249 (GRCm39) missense
R7805:Csmd2 UTSW 4 128,313,366 (GRCm39) missense
R7823:Csmd2 UTSW 4 128,103,698 (GRCm39) missense
R7904:Csmd2 UTSW 4 128,313,346 (GRCm39) missense
R7946:Csmd2 UTSW 4 128,414,058 (GRCm39) missense
R7964:Csmd2 UTSW 4 128,417,303 (GRCm39) missense
R7968:Csmd2 UTSW 4 128,091,118 (GRCm39) missense
R8003:Csmd2 UTSW 4 128,432,980 (GRCm39) nonsense probably null
R8071:Csmd2 UTSW 4 128,287,331 (GRCm39) missense
R8504:Csmd2 UTSW 4 128,440,483 (GRCm39) missense
R8511:Csmd2 UTSW 4 128,262,692 (GRCm39) missense
R8517:Csmd2 UTSW 4 128,446,479 (GRCm39) missense
R8704:Csmd2 UTSW 4 128,091,147 (GRCm39) missense
R8722:Csmd2 UTSW 4 128,445,743 (GRCm39) unclassified probably benign
R8729:Csmd2 UTSW 4 128,356,638 (GRCm39) missense
R8801:Csmd2 UTSW 4 128,457,195 (GRCm39) missense probably damaging 0.97
R8803:Csmd2 UTSW 4 128,440,477 (GRCm39) missense
R8839:Csmd2 UTSW 4 128,336,681 (GRCm39) missense
R8867:Csmd2 UTSW 4 128,451,469 (GRCm39) missense
R8913:Csmd2 UTSW 4 128,417,351 (GRCm39) missense
R8928:Csmd2 UTSW 4 128,369,582 (GRCm39) missense
R8974:Csmd2 UTSW 4 128,446,380 (GRCm39) missense
R9001:Csmd2 UTSW 4 128,308,079 (GRCm39) missense
R9132:Csmd2 UTSW 4 128,443,007 (GRCm39) missense
R9245:Csmd2 UTSW 4 128,200,168 (GRCm39) missense
R9249:Csmd2 UTSW 4 128,313,323 (GRCm39) nonsense probably null
R9254:Csmd2 UTSW 4 128,091,112 (GRCm39) missense
R9265:Csmd2 UTSW 4 128,294,163 (GRCm39) missense
R9407:Csmd2 UTSW 4 128,442,613 (GRCm39) missense
R9432:Csmd2 UTSW 4 128,171,004 (GRCm39) missense
R9559:Csmd2 UTSW 4 128,438,561 (GRCm39) missense
R9673:Csmd2 UTSW 4 128,308,062 (GRCm39) missense
R9735:Csmd2 UTSW 4 128,402,901 (GRCm39) missense
R9749:Csmd2 UTSW 4 128,389,921 (GRCm39) missense
R9803:Csmd2 UTSW 4 128,262,986 (GRCm39) missense
Z1177:Csmd2 UTSW 4 128,424,590 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- GAAGTTTCATAGTGCCGACAG -3'
(R):5'- TTGCAAAGGTCTAAGGATGACC -3'

Sequencing Primer
(F):5'- CCGACAGAGGCAACAGC -3'
(R):5'- GGATGACCTTCAAATTCCAGAAAG -3'
Posted On 2016-06-21