Incidental Mutation 'R5152:Pramef17'
ID395435
Institutional Source Beutler Lab
Gene Symbol Pramef17
Ensembl Gene ENSMUSG00000078509
Gene NamePRAME family member 17
SynonymsGm13107
MMRRC Submission 042734-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R5152 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location143991119-143994369 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 143994260 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 37 (P37L)
Ref Sequence ENSEMBL: ENSMUSP00000101388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105762]
Predicted Effect probably damaging
Transcript: ENSMUST00000105762
AA Change: P37L

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101388
Gene: ENSMUSG00000078509
AA Change: P37L

DomainStartEndE-ValueType
low complexity region 188 200 N/A INTRINSIC
SCOP:d1a4ya_ 205 408 5e-11 SMART
Meta Mutation Damage Score 0.368 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 99% (83/84)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T C 7: 120,540,623 S1503P probably benign Het
Actn3 C A 19: 4,863,544 V620F probably damaging Het
Adamtsl3 A G 7: 82,574,544 K252E probably benign Het
Adgrg1 A G 8: 95,009,745 Y509C probably damaging Het
Arhgef2 G A 3: 88,629,568 probably null Het
Bod1l T C 5: 41,816,543 E2476G probably benign Het
C130026I21Rik G A 1: 85,261,860 P19S probably benign Het
Capn3 T C 2: 120,501,330 probably benign Het
Catsperz T C 19: 6,923,337 T147A probably benign Het
Cc2d1b C A 4: 108,626,086 A289E probably benign Het
Ccdc170 A C 10: 4,561,107 H722P probably damaging Het
Cdk13 C A 13: 17,718,525 A1358S probably benign Het
Cntn6 T A 6: 104,569,113 probably benign Het
Coch A G 12: 51,595,442 N66D probably benign Het
Col12a1 A G 9: 79,656,748 S1732P probably damaging Het
Copa T A 1: 172,118,061 V917E probably benign Het
Csmd2 C A 4: 128,552,035 N3299K probably benign Het
Cyp2c67 A T 19: 39,638,688 F233I probably benign Het
D630039A03Rik T A 4: 57,910,434 H126L probably damaging Het
Ddx46 T C 13: 55,659,030 L492P probably damaging Het
Dpysl3 C T 18: 43,438,080 G43D probably benign Het
Enpp5 C T 17: 44,081,133 P151L probably damaging Het
Exoc3l4 T C 12: 111,430,893 probably benign Het
Faap100 T A 11: 120,377,632 E105V possibly damaging Het
Flg2 C A 3: 93,214,977 P1485T unknown Het
Fmo5 A G 3: 97,641,762 Y242C probably benign Het
Fsip2 C A 2: 82,978,572 T1745N probably benign Het
Gata4 T A 14: 63,241,121 N10Y probably damaging Het
Gm10722 A C 9: 3,001,041 Y39S probably benign Het
Gm4787 A C 12: 81,378,677 S236A probably benign Het
Gm9125 T C 3: 94,050,144 probably benign Het
Golga7 A C 8: 23,245,949 S94A probably benign Het
Gpbp1 A G 13: 111,453,281 probably benign Het
Grm1 A G 10: 11,079,875 Y222H probably benign Het
Gstcd A G 3: 133,084,956 Y17H possibly damaging Het
Hephl1 C A 9: 15,080,185 D586Y probably damaging Het
Hpn C A 7: 31,099,836 V35L probably damaging Het
Il23r T A 6: 67,423,741 N535I probably damaging Het
Inpp4a T C 1: 37,358,535 I45T possibly damaging Het
Itgae G C 11: 73,130,995 G901R probably damaging Het
Kif28 T C 1: 179,702,538 D686G probably damaging Het
Kit A G 5: 75,620,847 E312G probably benign Het
Lamb2 C A 9: 108,487,738 S1230R probably benign Het
Lars A T 18: 42,228,777 D588E possibly damaging Het
Lgr4 T A 2: 110,000,603 F292I probably damaging Het
Lmf1 C T 17: 25,655,519 S458L probably damaging Het
Lpin2 T A 17: 71,245,159 C787S probably damaging Het
Ms4a4a A C 19: 11,388,312 I138L probably benign Het
Mterf1a A T 5: 3,890,984 F295I probably damaging Het
Muc4 A T 16: 32,757,058 K241* probably null Het
Muc5b T C 7: 141,865,531 F4017S possibly damaging Het
Nfkbil1 T C 17: 35,221,408 probably benign Het
Olfr1269 A G 2: 90,119,121 L159P probably damaging Het
Olfr935 A T 9: 38,995,177 V86E possibly damaging Het
Olfr976 T C 9: 39,956,906 T22A probably benign Het
Osgep T C 14: 50,917,858 D81G probably damaging Het
Otos A G 1: 92,644,394 F70S probably damaging Het
Pcdhb2 T A 18: 37,296,126 V384D probably damaging Het
Ppp1r10 C T 17: 35,929,252 P514S probably damaging Het
Prdm16 A G 4: 154,346,102 Y309H probably damaging Het
Rap1gds1 A T 3: 138,956,201 D382E probably damaging Het
Reln A G 5: 21,948,629 F2226L probably damaging Het
Rmi2 C T 16: 10,839,901 T125M probably damaging Het
Setd1a C T 7: 127,784,025 T231I probably benign Het
Sftpa1 G A 14: 41,134,352 G218D probably damaging Het
Shcbp1 A T 8: 4,736,138 F655I probably damaging Het
Slc5a7 T C 17: 54,278,833 I319V possibly damaging Het
Spata31d1c C T 13: 65,035,595 T317I probably damaging Het
Speg C T 1: 75,428,098 P2845S possibly damaging Het
Synpo2 A G 3: 123,235,901 probably null Het
Tdrd7 T A 4: 46,013,191 S644T probably damaging Het
Tmem182 T A 1: 40,838,300 Y112N probably damaging Het
Usp45 T A 4: 21,824,815 N522K probably benign Het
Vnn3 A T 10: 23,864,339 Y180F probably benign Het
Wnk1 C T 6: 120,002,280 R282Q possibly damaging Het
Xrn1 A T 9: 95,964,065 D57V probably benign Het
Zfp831 T C 2: 174,644,564 V344A probably benign Het
Other mutations in Pramef17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Pramef17 APN 4 143993324 missense probably benign 0.01
IGL01981:Pramef17 APN 4 143994354 missense probably damaging 1.00
IGL02322:Pramef17 APN 4 143992021 splice site probably benign
IGL02514:Pramef17 APN 4 143993202 missense probably benign 0.12
IGL02806:Pramef17 APN 4 143992931 splice site probably null
IGL02888:Pramef17 APN 4 143994099 missense probably benign 0.42
IGL03032:Pramef17 APN 4 143993245 missense probably damaging 1.00
R0269:Pramef17 UTSW 4 143993518 splice site probably benign
R0363:Pramef17 UTSW 4 143991651 missense probably benign 0.01
R0617:Pramef17 UTSW 4 143993518 splice site probably benign
R1456:Pramef17 UTSW 4 143993281 missense probably benign
R1475:Pramef17 UTSW 4 143994312 missense probably benign 0.00
R1724:Pramef17 UTSW 4 143993432 missense probably benign 0.00
R2158:Pramef17 UTSW 4 143994315 missense possibly damaging 0.65
R2210:Pramef17 UTSW 4 143994219 missense probably benign
R3834:Pramef17 UTSW 4 143994226 missense probably benign 0.01
R4438:Pramef17 UTSW 4 143991622 missense probably damaging 1.00
R5832:Pramef17 UTSW 4 143991962 missense probably damaging 0.98
R6809:Pramef17 UTSW 4 143993081 missense probably benign 0.01
R6986:Pramef17 UTSW 4 143993318 missense probably damaging 0.99
R7072:Pramef17 UTSW 4 143994128 missense probably damaging 0.97
R7144:Pramef17 UTSW 4 143991533 missense probably benign 0.43
R7268:Pramef17 UTSW 4 143993520 splice site probably null
Predicted Primers PCR Primer
(F):5'- GGGACGATACTTCCGTTTCAG -3'
(R):5'- AACGTGGTCACCATGGAAAC -3'

Sequencing Primer
(F):5'- GTTTCAGCCATGTGCCAAC -3'
(R):5'- CAGGTGCTGAAGAGTTAAACTCCTC -3'
Posted On2016-06-21