Incidental Mutation 'R5152:Prdm16'
ID395436
Institutional Source Beutler Lab
Gene Symbol Prdm16
Ensembl Gene ENSMUSG00000039410
Gene NamePR domain containing 16
SynonymsMel1, 5730557K01Rik, csp1, line 27
MMRRC Submission 042734-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.743) question?
Stock #R5152 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location154316125-154636873 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 154346102 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 309 (Y309H)
Ref Sequence ENSEMBL: ENSMUSP00000101262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030902] [ENSMUST00000070313] [ENSMUST00000097759] [ENSMUST00000105636] [ENSMUST00000105637] [ENSMUST00000105638] [ENSMUST00000181143]
Predicted Effect probably damaging
Transcript: ENSMUST00000030902
AA Change: Y310H

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000030902
Gene: ENSMUSG00000039410
AA Change: Y310H

DomainStartEndE-ValueType
low complexity region 44 57 N/A INTRINSIC
low complexity region 74 83 N/A INTRINSIC
SET 84 217 8.75e-5 SMART
ZnF_C2H2 230 250 2.82e1 SMART
low complexity region 260 274 N/A INTRINSIC
ZnF_C2H2 282 304 1.04e-3 SMART
ZnF_C2H2 310 332 1.6e-4 SMART
ZnF_C2H2 338 361 3.95e-4 SMART
ZnF_C2H2 367 389 1.95e-3 SMART
ZnF_C2H2 395 417 8.22e-2 SMART
ZnF_C2H2 424 451 9.96e0 SMART
low complexity region 496 517 N/A INTRINSIC
low complexity region 520 540 N/A INTRINSIC
low complexity region 610 641 N/A INTRINSIC
ZnF_C2H2 951 973 5.29e-5 SMART
ZnF_C2H2 979 1002 1.6e-4 SMART
ZnF_C2H2 1008 1030 7.26e-3 SMART
low complexity region 1116 1132 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000070313
AA Change: Y311H

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000064546
Gene: ENSMUSG00000039410
AA Change: Y311H

DomainStartEndE-ValueType
low complexity region 44 57 N/A INTRINSIC
low complexity region 74 83 N/A INTRINSIC
SET 84 218 8.75e-5 SMART
ZnF_C2H2 231 251 2.82e1 SMART
low complexity region 261 275 N/A INTRINSIC
ZnF_C2H2 283 305 1.04e-3 SMART
ZnF_C2H2 311 333 1.6e-4 SMART
ZnF_C2H2 339 362 3.95e-4 SMART
ZnF_C2H2 368 390 1.95e-3 SMART
ZnF_C2H2 396 418 8.22e-2 SMART
ZnF_C2H2 425 452 9.96e0 SMART
low complexity region 497 518 N/A INTRINSIC
low complexity region 521 541 N/A INTRINSIC
low complexity region 611 642 N/A INTRINSIC
ZnF_C2H2 953 975 5.29e-5 SMART
ZnF_C2H2 981 1004 1.6e-4 SMART
ZnF_C2H2 1010 1032 7.26e-3 SMART
low complexity region 1118 1134 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097759
AA Change: Y310H

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000095365
Gene: ENSMUSG00000039410
AA Change: Y310H

DomainStartEndE-ValueType
low complexity region 44 57 N/A INTRINSIC
low complexity region 74 83 N/A INTRINSIC
SET 84 217 8.75e-5 SMART
ZnF_C2H2 230 250 2.82e1 SMART
low complexity region 260 274 N/A INTRINSIC
ZnF_C2H2 282 304 1.04e-3 SMART
ZnF_C2H2 310 332 1.6e-4 SMART
ZnF_C2H2 338 361 3.95e-4 SMART
ZnF_C2H2 367 389 1.95e-3 SMART
ZnF_C2H2 395 417 8.22e-2 SMART
ZnF_C2H2 424 451 9.96e0 SMART
low complexity region 496 517 N/A INTRINSIC
low complexity region 520 540 N/A INTRINSIC
low complexity region 610 641 N/A INTRINSIC
ZnF_C2H2 952 974 5.29e-5 SMART
ZnF_C2H2 980 1003 1.6e-4 SMART
ZnF_C2H2 1009 1031 7.26e-3 SMART
low complexity region 1117 1133 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105636
AA Change: Y311H

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101261
Gene: ENSMUSG00000039410
AA Change: Y311H

DomainStartEndE-ValueType
low complexity region 44 57 N/A INTRINSIC
low complexity region 74 83 N/A INTRINSIC
SET 84 218 8.75e-5 SMART
ZnF_C2H2 231 251 2.82e1 SMART
low complexity region 261 275 N/A INTRINSIC
ZnF_C2H2 283 305 1.04e-3 SMART
ZnF_C2H2 311 333 1.6e-4 SMART
ZnF_C2H2 339 362 3.95e-4 SMART
ZnF_C2H2 368 390 1.95e-3 SMART
ZnF_C2H2 396 418 8.22e-2 SMART
ZnF_C2H2 425 452 9.96e0 SMART
low complexity region 497 518 N/A INTRINSIC
low complexity region 521 541 N/A INTRINSIC
low complexity region 611 642 N/A INTRINSIC
ZnF_C2H2 952 974 5.29e-5 SMART
ZnF_C2H2 980 1003 1.6e-4 SMART
ZnF_C2H2 1009 1031 7.26e-3 SMART
low complexity region 1117 1133 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105637
AA Change: Y309H

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101262
Gene: ENSMUSG00000039410
AA Change: Y309H

DomainStartEndE-ValueType
low complexity region 44 57 N/A INTRINSIC
low complexity region 74 83 N/A INTRINSIC
SET 84 216 8.75e-5 SMART
ZnF_C2H2 229 249 2.82e1 SMART
low complexity region 259 273 N/A INTRINSIC
ZnF_C2H2 281 303 1.04e-3 SMART
ZnF_C2H2 309 331 1.6e-4 SMART
ZnF_C2H2 337 360 3.95e-4 SMART
ZnF_C2H2 366 388 1.95e-3 SMART
ZnF_C2H2 394 416 8.22e-2 SMART
ZnF_C2H2 423 450 9.96e0 SMART
low complexity region 495 516 N/A INTRINSIC
low complexity region 519 539 N/A INTRINSIC
low complexity region 609 640 N/A INTRINSIC
ZnF_C2H2 950 972 5.29e-5 SMART
ZnF_C2H2 978 1001 1.6e-4 SMART
ZnF_C2H2 1007 1029 7.26e-3 SMART
low complexity region 1115 1131 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105638
AA Change: Y310H

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101263
Gene: ENSMUSG00000039410
AA Change: Y310H

DomainStartEndE-ValueType
low complexity region 44 57 N/A INTRINSIC
low complexity region 74 83 N/A INTRINSIC
SET 84 217 8.75e-5 SMART
ZnF_C2H2 230 250 2.82e1 SMART
low complexity region 260 274 N/A INTRINSIC
ZnF_C2H2 282 304 1.04e-3 SMART
ZnF_C2H2 310 332 1.6e-4 SMART
ZnF_C2H2 338 361 3.95e-4 SMART
ZnF_C2H2 367 389 1.95e-3 SMART
ZnF_C2H2 395 417 8.22e-2 SMART
ZnF_C2H2 424 451 9.96e0 SMART
low complexity region 496 517 N/A INTRINSIC
low complexity region 520 540 N/A INTRINSIC
low complexity region 610 641 N/A INTRINSIC
ZnF_C2H2 952 974 5.29e-5 SMART
ZnF_C2H2 980 1003 1.6e-4 SMART
ZnF_C2H2 1009 1031 7.26e-3 SMART
low complexity region 1117 1133 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131762
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141164
Predicted Effect probably benign
Transcript: ENSMUST00000181143
SMART Domains Protein: ENSMUSP00000138001
Gene: ENSMUSG00000097871

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
Meta Mutation Damage Score 0.13 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The reciprocal translocation t(1;3)(p36;q21) occurs in a subset of myelodysplastic syndrome (MDS) and acute myeloid leukemia (AML). This gene is located near the 1p36.3 breakpoint and has been shown to be specifically expressed in the t(1:3)(p36,q21)-positive MDS/AML. The protein encoded by this gene is a zinc finger transcription factor and contains an N-terminal PR domain. The translocation results in the overexpression of a truncated version of this protein that lacks the PR domain, which may play an important role in the pathogenesis of MDS and AML. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice exhibit a cleft secondary palate, whitening of brown adipose tissue in older or fed a high-fat diet, and impaired adaptive thermogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T C 7: 120,540,623 S1503P probably benign Het
Actn3 C A 19: 4,863,544 V620F probably damaging Het
Adamtsl3 A G 7: 82,574,544 K252E probably benign Het
Adgrg1 A G 8: 95,009,745 Y509C probably damaging Het
Arhgef2 G A 3: 88,629,568 probably null Het
Bod1l T C 5: 41,816,543 E2476G probably benign Het
C130026I21Rik G A 1: 85,261,860 P19S probably benign Het
Capn3 T C 2: 120,501,330 probably benign Het
Catsperz T C 19: 6,923,337 T147A probably benign Het
Cc2d1b C A 4: 108,626,086 A289E probably benign Het
Ccdc170 A C 10: 4,561,107 H722P probably damaging Het
Cdk13 C A 13: 17,718,525 A1358S probably benign Het
Cntn6 T A 6: 104,569,113 probably benign Het
Coch A G 12: 51,595,442 N66D probably benign Het
Col12a1 A G 9: 79,656,748 S1732P probably damaging Het
Copa T A 1: 172,118,061 V917E probably benign Het
Csmd2 C A 4: 128,552,035 N3299K probably benign Het
Cyp2c67 A T 19: 39,638,688 F233I probably benign Het
D630039A03Rik T A 4: 57,910,434 H126L probably damaging Het
Ddx46 T C 13: 55,659,030 L492P probably damaging Het
Dpysl3 C T 18: 43,438,080 G43D probably benign Het
Enpp5 C T 17: 44,081,133 P151L probably damaging Het
Exoc3l4 T C 12: 111,430,893 probably benign Het
Faap100 T A 11: 120,377,632 E105V possibly damaging Het
Flg2 C A 3: 93,214,977 P1485T unknown Het
Fmo5 A G 3: 97,641,762 Y242C probably benign Het
Fsip2 C A 2: 82,978,572 T1745N probably benign Het
Gata4 T A 14: 63,241,121 N10Y probably damaging Het
Gm10722 A C 9: 3,001,041 Y39S probably benign Het
Gm4787 A C 12: 81,378,677 S236A probably benign Het
Gm9125 T C 3: 94,050,144 probably benign Het
Golga7 A C 8: 23,245,949 S94A probably benign Het
Gpbp1 A G 13: 111,453,281 probably benign Het
Grm1 A G 10: 11,079,875 Y222H probably benign Het
Gstcd A G 3: 133,084,956 Y17H possibly damaging Het
Hephl1 C A 9: 15,080,185 D586Y probably damaging Het
Hpn C A 7: 31,099,836 V35L probably damaging Het
Il23r T A 6: 67,423,741 N535I probably damaging Het
Inpp4a T C 1: 37,358,535 I45T possibly damaging Het
Itgae G C 11: 73,130,995 G901R probably damaging Het
Kif28 T C 1: 179,702,538 D686G probably damaging Het
Kit A G 5: 75,620,847 E312G probably benign Het
Lamb2 C A 9: 108,487,738 S1230R probably benign Het
Lars A T 18: 42,228,777 D588E possibly damaging Het
Lgr4 T A 2: 110,000,603 F292I probably damaging Het
Lmf1 C T 17: 25,655,519 S458L probably damaging Het
Lpin2 T A 17: 71,245,159 C787S probably damaging Het
Ms4a4a A C 19: 11,388,312 I138L probably benign Het
Mterf1a A T 5: 3,890,984 F295I probably damaging Het
Muc4 A T 16: 32,757,058 K241* probably null Het
Muc5b T C 7: 141,865,531 F4017S possibly damaging Het
Nfkbil1 T C 17: 35,221,408 probably benign Het
Olfr1269 A G 2: 90,119,121 L159P probably damaging Het
Olfr935 A T 9: 38,995,177 V86E possibly damaging Het
Olfr976 T C 9: 39,956,906 T22A probably benign Het
Osgep T C 14: 50,917,858 D81G probably damaging Het
Otos A G 1: 92,644,394 F70S probably damaging Het
Pcdhb2 T A 18: 37,296,126 V384D probably damaging Het
Ppp1r10 C T 17: 35,929,252 P514S probably damaging Het
Pramef17 G A 4: 143,994,260 P37L probably damaging Het
Rap1gds1 A T 3: 138,956,201 D382E probably damaging Het
Reln A G 5: 21,948,629 F2226L probably damaging Het
Rmi2 C T 16: 10,839,901 T125M probably damaging Het
Setd1a C T 7: 127,784,025 T231I probably benign Het
Sftpa1 G A 14: 41,134,352 G218D probably damaging Het
Shcbp1 A T 8: 4,736,138 F655I probably damaging Het
Slc5a7 T C 17: 54,278,833 I319V possibly damaging Het
Spata31d1c C T 13: 65,035,595 T317I probably damaging Het
Speg C T 1: 75,428,098 P2845S possibly damaging Het
Synpo2 A G 3: 123,235,901 probably null Het
Tdrd7 T A 4: 46,013,191 S644T probably damaging Het
Tmem182 T A 1: 40,838,300 Y112N probably damaging Het
Usp45 T A 4: 21,824,815 N522K probably benign Het
Vnn3 A T 10: 23,864,339 Y180F probably benign Het
Wnk1 C T 6: 120,002,280 R282Q possibly damaging Het
Xrn1 A T 9: 95,964,065 D57V probably benign Het
Zfp831 T C 2: 174,644,564 V344A probably benign Het
Other mutations in Prdm16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Prdm16 APN 4 154341969 missense possibly damaging 0.89
IGL01517:Prdm16 APN 4 154328425 missense probably damaging 1.00
IGL01810:Prdm16 APN 4 154347927 missense probably benign 0.10
IGL02260:Prdm16 APN 4 154328287 missense probably benign 0.00
IGL02623:Prdm16 APN 4 154340877 missense probably damaging 0.98
IGL02744:Prdm16 APN 4 154345453 missense probably damaging 1.00
R0126:Prdm16 UTSW 4 154328838 splice site probably benign
R0345:Prdm16 UTSW 4 154341111 missense probably benign 0.09
R0365:Prdm16 UTSW 4 154342056 missense probably damaging 1.00
R0440:Prdm16 UTSW 4 154476627 splice site probably benign
R0899:Prdm16 UTSW 4 154528909 missense probably damaging 1.00
R1127:Prdm16 UTSW 4 154528799 missense probably damaging 1.00
R1546:Prdm16 UTSW 4 154528660 missense possibly damaging 0.94
R1803:Prdm16 UTSW 4 154335261 missense probably damaging 1.00
R2117:Prdm16 UTSW 4 154347925 missense probably null 0.99
R3814:Prdm16 UTSW 4 154328293 missense probably damaging 1.00
R4348:Prdm16 UTSW 4 154476667 missense probably benign 0.00
R4458:Prdm16 UTSW 4 154322308 missense probably benign
R4557:Prdm16 UTSW 4 154528827 missense probably benign 0.01
R4581:Prdm16 UTSW 4 154323353 missense probably damaging 1.00
R4584:Prdm16 UTSW 4 154337683 missense probably damaging 1.00
R4627:Prdm16 UTSW 4 154367240 missense probably damaging 1.00
R4926:Prdm16 UTSW 4 154341552 missense possibly damaging 0.74
R5055:Prdm16 UTSW 4 154335262 missense possibly damaging 0.48
R5257:Prdm16 UTSW 4 154367214 missense possibly damaging 0.89
R5258:Prdm16 UTSW 4 154367214 missense possibly damaging 0.89
R5368:Prdm16 UTSW 4 154345391 missense probably damaging 1.00
R5464:Prdm16 UTSW 4 154346144 critical splice acceptor site probably null
R5640:Prdm16 UTSW 4 154341910 missense probably benign
R5744:Prdm16 UTSW 4 154528704 missense probably damaging 1.00
R5892:Prdm16 UTSW 4 154323259 missense possibly damaging 0.74
R5938:Prdm16 UTSW 4 154347954 missense probably damaging 0.99
R6380:Prdm16 UTSW 4 154341367 missense probably benign 0.00
R6784:Prdm16 UTSW 4 154323307 missense probably damaging 1.00
R7097:Prdm16 UTSW 4 154345468 missense probably damaging 1.00
R7181:Prdm16 UTSW 4 154528637 missense probably damaging 1.00
R7197:Prdm16 UTSW 4 154341510 missense probably damaging 1.00
R7273:Prdm16 UTSW 4 154345453 missense probably damaging 1.00
R7379:Prdm16 UTSW 4 154528859 missense probably damaging 1.00
X0010:Prdm16 UTSW 4 154323377 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAACCTAAGGACCTCAGGAC -3'
(R):5'- GAGGTAGAGTTTGCACGCATTC -3'

Sequencing Primer
(F):5'- TAAGGACCTCAGGACATCTAATCC -3'
(R):5'- GGTAGAGTTTGCACGCATTCCAATC -3'
Posted On2016-06-21