Mutagenetix > Incidental Mutation

Incidental Mutation 'R5152:Cntn6'

395441

Institutional Source

Beutler Lab

Gene Symbol

Cntn6

Ensembl Gene

ENSMUSG00000030092

Gene Name

contactin 6

Synonyms

NB-3

MMRRC Submission

042734-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.133) question?

Stock #

R5152 (G1)

Quality Score

192

Status

Validated

Chromosome

Chromosomal Location

104492790-104863406 bp(+) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

T to A at 104569113 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000124025 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000089215] [ENSMUST00000161070] [ENSMUST00000161446] [ENSMUST00000162872]

AlphaFold

Q9JMB8

Predicted Effect

probably benign
Transcript: ENSMUST00000089215

SMART Domains

Protein: ENSMUSP00000086623
Gene: ENSMUSG00000030092

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IGc2	41	107	5.24e-7	SMART
IG	129	217	2.28e-7	SMART
IGc2	240	304	4e-12	SMART
IGc2	330	393	4.52e-11	SMART
IGc2	422	486	5.48e-10	SMART
IGc2	512	584	1.44e-4	SMART
FN3	598	684	2.17e-11	SMART
FN3	701	787	8.62e0	SMART
FN3	803	888	9.92e-6	SMART
FN3	903	983	8.17e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000161070

SMART Domains

Protein: ENSMUSP00000124714
Gene: ENSMUSG00000030092

Domain	Start	End	E-Value	Type
SCOP:d1cs6a4	4	40	5e-4	SMART
IG	57	145	2.28e-7	SMART
IGc2	168	232	4e-12	SMART
IGc2	258	321	4.52e-11	SMART
IGc2	350	414	5.48e-10	SMART
IGc2	440	512	1.44e-4	SMART
FN3	526	612	2.17e-11	SMART
FN3	629	715	8.62e0	SMART
FN3	731	816	9.92e-6	SMART
FN3	831	911	8.17e0	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161413

Predicted Effect

probably benign
Transcript: ENSMUST00000161446

Predicted Effect

probably benign
Transcript: ENSMUST00000162872

SMART Domains

Protein: ENSMUSP00000124025
Gene: ENSMUSG00000030092

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IGc2	41	107	5.24e-7	SMART
IG	129	217	2.28e-7	SMART
IGc2	240	304	4e-12	SMART
IGc2	330	393	4.52e-11	SMART
IGc2	422	486	5.48e-10	SMART
IGc2	512	584	1.44e-4	SMART
FN3	598	684	2.17e-11	SMART
FN3	701	787	8.62e0	SMART
FN3	803	888	9.92e-6	SMART
FN3	903	983	8.17e0	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.4%

Validation Efficiency

99% (83/84)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. It is a glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein that functions as a cell adhesion molecule. It may play a role in the formation of axon connections in the developing nervous system. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for disruption of this gene display impaired coordination without any obvious morphological of physiological abnormalities in the brain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca16	T	C	7: 120,540,623	S1503P	probably benign	Het
Actn3	C	A	19: 4,863,544	V620F	probably damaging	Het
Adamtsl3	A	G	7: 82,574,544	K252E	probably benign	Het
Adgrg1	A	G	8: 95,009,745	Y509C	probably damaging	Het
Arhgef2	G	A	3: 88,629,568		probably null	Het
Bod1l	T	C	5: 41,816,543	E2476G	probably benign	Het
C130026I21Rik	G	A	1: 85,261,860	P19S	probably benign	Het
Capn3	T	C	2: 120,501,330		probably benign	Het
Catsperz	T	C	19: 6,923,337	T147A	probably benign	Het
Cc2d1b	C	A	4: 108,626,086	A289E	probably benign	Het
Ccdc170	A	C	10: 4,561,107	H722P	probably damaging	Het
Cdk13	C	A	13: 17,718,525	A1358S	probably benign	Het
Coch	A	G	12: 51,595,442	N66D	probably benign	Het
Col12a1	A	G	9: 79,656,748	S1732P	probably damaging	Het
Copa	T	A	1: 172,118,061	V917E	probably benign	Het
Csmd2	C	A	4: 128,552,035	N3299K	probably benign	Het
Cyp2c67	A	T	19: 39,638,688	F233I	probably benign	Het
D630039A03Rik	T	A	4: 57,910,434	H126L	probably damaging	Het
Ddx46	T	C	13: 55,659,030	L492P	probably damaging	Het
Dpysl3	C	T	18: 43,438,080	G43D	probably benign	Het
Enpp5	C	T	17: 44,081,133	P151L	probably damaging	Het
Exoc3l4	T	C	12: 111,430,893		probably benign	Het
Faap100	T	A	11: 120,377,632	E105V	possibly damaging	Het
Flg2	C	A	3: 93,214,977	P1485T	unknown	Het
Fmo5	A	G	3: 97,641,762	Y242C	probably benign	Het
Fsip2	C	A	2: 82,978,572	T1745N	probably benign	Het
Gata4	T	A	14: 63,241,121	N10Y	probably damaging	Het
Gm10722	A	C	9: 3,001,041	Y39S	probably benign	Het
Gm4787	A	C	12: 81,378,677	S236A	probably benign	Het
Gm9125	T	C	3: 94,050,144		probably benign	Het
Golga7	A	C	8: 23,245,949	S94A	probably benign	Het
Gpbp1	A	G	13: 111,453,281		probably benign	Het
Grm1	A	G	10: 11,079,875	Y222H	probably benign	Het
Gstcd	A	G	3: 133,084,956	Y17H	possibly damaging	Het
Hephl1	C	A	9: 15,080,185	D586Y	probably damaging	Het
Hpn	C	A	7: 31,099,836	V35L	probably damaging	Het
Il23r	T	A	6: 67,423,741	N535I	probably damaging	Het
Inpp4a	T	C	1: 37,358,535	I45T	possibly damaging	Het
Itgae	G	C	11: 73,130,995	G901R	probably damaging	Het
Kif28	T	C	1: 179,702,538	D686G	probably damaging	Het
Kit	A	G	5: 75,620,847	E312G	probably benign	Het
Lamb2	C	A	9: 108,487,738	S1230R	probably benign	Het
Lars	A	T	18: 42,228,777	D588E	possibly damaging	Het
Lgr4	T	A	2: 110,000,603	F292I	probably damaging	Het
Lmf1	C	T	17: 25,655,519	S458L	probably damaging	Het
Lpin2	T	A	17: 71,245,159	C787S	probably damaging	Het
Ms4a4a	A	C	19: 11,388,312	I138L	probably benign	Het
Mterf1a	A	T	5: 3,890,984	F295I	probably damaging	Het
Muc4	A	T	16: 32,757,058	K241*	probably null	Het
Muc5b	T	C	7: 141,865,531	F4017S	possibly damaging	Het
Nfkbil1	T	C	17: 35,221,408		probably benign	Het
Olfr1269	A	G	2: 90,119,121	L159P	probably damaging	Het
Olfr935	A	T	9: 38,995,177	V86E	possibly damaging	Het
Olfr976	T	C	9: 39,956,906	T22A	probably benign	Het
Osgep	T	C	14: 50,917,858	D81G	probably damaging	Het
Otos	A	G	1: 92,644,394	F70S	probably damaging	Het
Pcdhb2	T	A	18: 37,296,126	V384D	probably damaging	Het
Ppp1r10	C	T	17: 35,929,252	P514S	probably damaging	Het
Pramef17	G	A	4: 143,994,260	P37L	probably damaging	Het
Prdm16	A	G	4: 154,346,102	Y309H	probably damaging	Het
Rap1gds1	A	T	3: 138,956,201	D382E	probably damaging	Het
Reln	A	G	5: 21,948,629	F2226L	probably damaging	Het
Rmi2	C	T	16: 10,839,901	T125M	probably damaging	Het
Setd1a	C	T	7: 127,784,025	T231I	probably benign	Het
Sftpa1	G	A	14: 41,134,352	G218D	probably damaging	Het
Shcbp1	A	T	8: 4,736,138	F655I	probably damaging	Het
Slc5a7	T	C	17: 54,278,833	I319V	possibly damaging	Het
Spata31d1c	C	T	13: 65,035,595	T317I	probably damaging	Het
Speg	C	T	1: 75,428,098	P2845S	possibly damaging	Het
Synpo2	A	G	3: 123,235,901		probably null	Het
Tdrd7	T	A	4: 46,013,191	S644T	probably damaging	Het
Tmem182	T	A	1: 40,838,300	Y112N	probably damaging	Het
Usp45	T	A	4: 21,824,815	N522K	probably benign	Het
Vnn3	A	T	10: 23,864,339	Y180F	probably benign	Het
Wnk1	C	T	6: 120,002,280	R282Q	possibly damaging	Het
Xrn1	A	T	9: 95,964,065	D57V	probably benign	Het
Zfp831	T	C	2: 174,644,564	V344A	probably benign	Het

Other mutations in Cntn6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00547:Cntn6	APN	6	104650400	missense	probably damaging	0.99
IGL01331:Cntn6	APN	6	104774523	missense	probably damaging	1.00
IGL01619:Cntn6	APN	6	104728374	splice site	probably benign
IGL02028:Cntn6	APN	6	104859426	missense	probably damaging	0.99
IGL02420:Cntn6	APN	6	104846142	critical splice donor site	probably null
IGL02557:Cntn6	APN	6	104774535	missense	probably damaging	1.00
IGL03000:Cntn6	APN	6	104804386	missense	probably damaging	1.00
IGL03367:Cntn6	APN	6	104804338	missense	probably damaging	1.00
IGL03383:Cntn6	APN	6	104776457	splice site	probably benign
PIT4366001:Cntn6	UTSW	6	104832537	missense	probably benign	0.05
R0490:Cntn6	UTSW	6	104833918	missense	possibly damaging	0.91
R0583:Cntn6	UTSW	6	104776314	missense	possibly damaging	0.79
R0636:Cntn6	UTSW	6	104863148	missense	probably benign	0.00
R0654:Cntn6	UTSW	6	104776428	missense	probably benign	0.00
R0960:Cntn6	UTSW	6	104774480	missense	probably benign	0.01
R1241:Cntn6	UTSW	6	104832509	missense	probably damaging	1.00
R1385:Cntn6	UTSW	6	104861900	missense	probably benign	0.07
R1401:Cntn6	UTSW	6	104804398	missense	possibly damaging	0.65
R1478:Cntn6	UTSW	6	104776428	missense	probably benign	0.00
R1542:Cntn6	UTSW	6	104848100	missense	probably damaging	1.00
R1593:Cntn6	UTSW	6	104832580	missense	possibly damaging	0.58
R1840:Cntn6	UTSW	6	104774480	missense	probably damaging	1.00
R2066:Cntn6	UTSW	6	104861822	nonsense	probably null
R2097:Cntn6	UTSW	6	104861949	missense	probably damaging	0.99
R2289:Cntn6	UTSW	6	104569028	start gained	probably benign
R2429:Cntn6	UTSW	6	104650565	missense	possibly damaging	0.96
R2967:Cntn6	UTSW	6	104726237	missense	probably benign	0.04
R4009:Cntn6	UTSW	6	104833822	missense	probably damaging	0.98
R4476:Cntn6	UTSW	6	104772561	missense	probably damaging	1.00
R4664:Cntn6	UTSW	6	104728284	missense	probably benign	0.20
R4666:Cntn6	UTSW	6	104728284	missense	probably benign	0.20
R4701:Cntn6	UTSW	6	104804360	missense	probably benign	0.01
R4780:Cntn6	UTSW	6	104845784	missense	probably damaging	1.00
R4854:Cntn6	UTSW	6	104859475	missense	possibly damaging	0.95
R4965:Cntn6	UTSW	6	104774474	missense	probably damaging	0.99
R5051:Cntn6	UTSW	6	104772597	missense	probably damaging	1.00
R5075:Cntn6	UTSW	6	104833030	missense	probably damaging	1.00
R5291:Cntn6	UTSW	6	104726135	missense	probably damaging	1.00
R5388:Cntn6	UTSW	6	104832562	missense	probably damaging	1.00
R5852:Cntn6	UTSW	6	104835745	missense	probably damaging	0.97
R5937:Cntn6	UTSW	6	104833103	missense	possibly damaging	0.68
R5980:Cntn6	UTSW	6	104848132	missense	probably damaging	0.98
R6290:Cntn6	UTSW	6	104767890	missense	probably damaging	1.00
R6338:Cntn6	UTSW	6	104726139	missense	probably damaging	1.00
R6396:Cntn6	UTSW	6	104650500	missense	probably damaging	1.00
R6447:Cntn6	UTSW	6	104859448	missense	probably damaging	1.00
R6860:Cntn6	UTSW	6	104861946	missense	possibly damaging	0.95
R6871:Cntn6	UTSW	6	104845758	frame shift	probably null
R7012:Cntn6	UTSW	6	104726262	missense	probably damaging	0.98
R7012:Cntn6	UTSW	6	104774480	missense	probably benign	0.01
R7337:Cntn6	UTSW	6	104650530	missense	probably damaging	0.99
R7658:Cntn6	UTSW	6	104650483	missense	probably benign	0.29
R8133:Cntn6	UTSW	6	104728337	missense	probably benign	0.19
R8463:Cntn6	UTSW	6	104772619	missense	possibly damaging	0.64
R8909:Cntn6	UTSW	6	104848132	missense	probably benign	0.05
R9232:Cntn6	UTSW	6	104838820	missense	probably damaging	1.00
R9287:Cntn6	UTSW	6	104832510	missense	possibly damaging	0.89
R9454:Cntn6	UTSW	6	104804347	missense	possibly damaging	0.82
R9698:Cntn6	UTSW	6	104833083	nonsense	probably null
X0020:Cntn6	UTSW	6	104767884	missense	probably benign	0.00
Z1177:Cntn6	UTSW	6	104832584	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTGGGCTGATATGTGAGAAAC -3'
(R):5'- AAACATGTCTGACCTTCCCTTTTGG -3'

Sequencing Primer
(F):5'- GAAACTGAGTAGTCATTTATGTGGC -3'
(R):5'- CCCTTTTGGTTATTGATGGAAAGAAG -3'

Posted On

2016-06-21