Incidental Mutation 'R5152:Setd1a'
ID 395446
Institutional Source Beutler Lab
Gene Symbol Setd1a
Ensembl Gene ENSMUSG00000042308
Gene Name SET domain containing 1A
Synonyms KMT2F
MMRRC Submission 042734-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5152 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 127376561-127399294 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 127383197 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 231 (T231I)
Ref Sequence ENSEMBL: ENSMUSP00000115248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047075] [ENSMUST00000047157] [ENSMUST00000126761] [ENSMUST00000144406] [ENSMUST00000154987]
AlphaFold E9PYH6
Predicted Effect unknown
Transcript: ENSMUST00000047075
AA Change: T231I
SMART Domains Protein: ENSMUSP00000047672
Gene: ENSMUSG00000042308
AA Change: T231I

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
low complexity region 278 295 N/A INTRINSIC
low complexity region 315 357 N/A INTRINSIC
low complexity region 427 487 N/A INTRINSIC
Blast:SET 488 976 N/A BLAST
low complexity region 977 1007 N/A INTRINSIC
low complexity region 1015 1079 N/A INTRINSIC
low complexity region 1087 1098 N/A INTRINSIC
low complexity region 1122 1152 N/A INTRINSIC
low complexity region 1157 1173 N/A INTRINSIC
Blast:SET 1193 1310 2e-24 BLAST
low complexity region 1311 1368 N/A INTRINSIC
low complexity region 1369 1396 N/A INTRINSIC
N-SET 1428 1567 6.75e-64 SMART
SET 1577 1700 3.22e-35 SMART
PostSET 1700 1716 1.16e-4 SMART
Predicted Effect unknown
Transcript: ENSMUST00000047157
AA Change: T231I
SMART Domains Protein: ENSMUSP00000037600
Gene: ENSMUSG00000042308
AA Change: T231I

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
low complexity region 278 295 N/A INTRINSIC
low complexity region 315 357 N/A INTRINSIC
low complexity region 427 487 N/A INTRINSIC
Blast:SET 488 976 N/A BLAST
low complexity region 977 1007 N/A INTRINSIC
low complexity region 1015 1079 N/A INTRINSIC
low complexity region 1087 1098 N/A INTRINSIC
low complexity region 1122 1152 N/A INTRINSIC
low complexity region 1157 1173 N/A INTRINSIC
Blast:SET 1193 1310 2e-24 BLAST
low complexity region 1311 1368 N/A INTRINSIC
low complexity region 1369 1396 N/A INTRINSIC
N-SET 1428 1567 6.75e-64 SMART
SET 1577 1700 3.22e-35 SMART
PostSET 1700 1716 1.16e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126761
SMART Domains Protein: ENSMUSP00000120666
Gene: ENSMUSG00000042308

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141439
Predicted Effect probably benign
Transcript: ENSMUST00000144406
AA Change: T231I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000115248
Gene: ENSMUSG00000042308
AA Change: T231I

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154987
Meta Mutation Damage Score 0.0620 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of a histone methyltransferase (HMT) complex that produces mono-, di-, and trimethylated histone H3 at Lys4. Trimethylation of histone H3 at lysine 4 (H3K4me3) is a chromatin modification known to generally mark the transcription start sites of active genes. The protein contains SET domains, a RNA recognition motif domain and is a member of the class V-like SAM-binding methyltransferase superfamily. [provided by RefSeq, Dec 2016]
PHENOTYPE: Animals homozygous for this allele were dead by E7.5 [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T C 7: 120,139,846 (GRCm39) S1503P probably benign Het
Actn3 C A 19: 4,913,572 (GRCm39) V620F probably damaging Het
Adamtsl3 A G 7: 82,223,752 (GRCm39) K252E probably benign Het
Adgrg1 A G 8: 95,736,373 (GRCm39) Y509C probably damaging Het
Arhgef2 G A 3: 88,536,875 (GRCm39) probably null Het
Bod1l T C 5: 41,973,886 (GRCm39) E2476G probably benign Het
Capn3 T C 2: 120,331,811 (GRCm39) probably benign Het
Catsperz T C 19: 6,900,705 (GRCm39) T147A probably benign Het
Cc2d1b C A 4: 108,483,283 (GRCm39) A289E probably benign Het
Ccdc170 A C 10: 4,511,107 (GRCm39) H722P probably damaging Het
Cdk13 C A 13: 17,893,110 (GRCm39) A1358S probably benign Het
Cntn6 T A 6: 104,546,074 (GRCm39) probably benign Het
Coch A G 12: 51,642,225 (GRCm39) N66D probably benign Het
Col12a1 A G 9: 79,564,030 (GRCm39) S1732P probably damaging Het
Copa T A 1: 171,945,628 (GRCm39) V917E probably benign Het
Csmd2 C A 4: 128,445,828 (GRCm39) N3299K probably benign Het
Cyp2c67 A T 19: 39,627,132 (GRCm39) F233I probably benign Het
D630039A03Rik T A 4: 57,910,434 (GRCm39) H126L probably damaging Het
Ddx46 T C 13: 55,806,843 (GRCm39) L492P probably damaging Het
Dpysl3 C T 18: 43,571,145 (GRCm39) G43D probably benign Het
Enpp5 C T 17: 44,392,024 (GRCm39) P151L probably damaging Het
Exoc3l4 T C 12: 111,397,327 (GRCm39) probably benign Het
Faap100 T A 11: 120,268,458 (GRCm39) E105V possibly damaging Het
Flg2 C A 3: 93,122,284 (GRCm39) P1485T unknown Het
Fmo5 A G 3: 97,549,078 (GRCm39) Y242C probably benign Het
Fsip2 C A 2: 82,808,916 (GRCm39) T1745N probably benign Het
Gata4 T A 14: 63,478,570 (GRCm39) N10Y probably damaging Het
Gm10722 A C 9: 3,001,041 (GRCm39) Y39S probably benign Het
Gm4787 A C 12: 81,425,451 (GRCm39) S236A probably benign Het
Golga7 A C 8: 23,735,965 (GRCm39) S94A probably benign Het
Gpbp1 A G 13: 111,589,815 (GRCm39) probably benign Het
Grm1 A G 10: 10,955,619 (GRCm39) Y222H probably benign Het
Gstcd A G 3: 132,790,717 (GRCm39) Y17H possibly damaging Het
Hephl1 C A 9: 14,991,481 (GRCm39) D586Y probably damaging Het
Hpn C A 7: 30,799,261 (GRCm39) V35L probably damaging Het
Il23r T A 6: 67,400,725 (GRCm39) N535I probably damaging Het
Inpp4a T C 1: 37,397,616 (GRCm39) I45T possibly damaging Het
Itgae G C 11: 73,021,821 (GRCm39) G901R probably damaging Het
Kif28 T C 1: 179,530,103 (GRCm39) D686G probably damaging Het
Kit A G 5: 75,781,507 (GRCm39) E312G probably benign Het
Lamb2 C A 9: 108,364,937 (GRCm39) S1230R probably benign Het
Lars1 A T 18: 42,361,842 (GRCm39) D588E possibly damaging Het
Lgr4 T A 2: 109,830,948 (GRCm39) F292I probably damaging Het
Lmf1 C T 17: 25,874,493 (GRCm39) S458L probably damaging Het
Lpin2 T A 17: 71,552,154 (GRCm39) C787S probably damaging Het
Ms4a4a A C 19: 11,365,676 (GRCm39) I138L probably benign Het
Mterf1a A T 5: 3,940,984 (GRCm39) F295I probably damaging Het
Muc4 A T 16: 32,577,432 (GRCm39) K241* probably null Het
Muc5b T C 7: 141,419,268 (GRCm39) F4017S possibly damaging Het
Nfkbil1 T C 17: 35,440,384 (GRCm39) probably benign Het
Or10d5j T C 9: 39,868,202 (GRCm39) T22A probably benign Het
Or4x6 A G 2: 89,949,465 (GRCm39) L159P probably damaging Het
Or8g21 A T 9: 38,906,473 (GRCm39) V86E possibly damaging Het
Osgep T C 14: 51,155,315 (GRCm39) D81G probably damaging Het
Otos A G 1: 92,572,116 (GRCm39) F70S probably damaging Het
Pcdhb2 T A 18: 37,429,179 (GRCm39) V384D probably damaging Het
Ppp1r10 C T 17: 36,240,144 (GRCm39) P514S probably damaging Het
Pramel14 G A 4: 143,720,830 (GRCm39) P37L probably damaging Het
Prdm16 A G 4: 154,430,559 (GRCm39) Y309H probably damaging Het
Rap1gds1 A T 3: 138,661,962 (GRCm39) D382E probably damaging Het
Reln A G 5: 22,153,627 (GRCm39) F2226L probably damaging Het
Rmi2 C T 16: 10,657,765 (GRCm39) T125M probably damaging Het
Sftpa1 G A 14: 40,856,309 (GRCm39) G218D probably damaging Het
Shcbp1 A T 8: 4,786,138 (GRCm39) F655I probably damaging Het
Slc5a7 T C 17: 54,585,861 (GRCm39) I319V possibly damaging Het
Sp140l2 G A 1: 85,239,581 (GRCm39) P19S probably benign Het
Spata31d1c C T 13: 65,183,409 (GRCm39) T317I probably damaging Het
Speg C T 1: 75,404,742 (GRCm39) P2845S possibly damaging Het
Synpo2 A G 3: 123,029,550 (GRCm39) probably null Het
Tdpoz9 T C 3: 93,957,451 (GRCm39) probably benign Het
Tdrd7 T A 4: 46,013,191 (GRCm39) S644T probably damaging Het
Tmem182 T A 1: 40,877,460 (GRCm39) Y112N probably damaging Het
Usp45 T A 4: 21,824,815 (GRCm39) N522K probably benign Het
Vnn3 A T 10: 23,740,237 (GRCm39) Y180F probably benign Het
Wnk1 C T 6: 119,979,241 (GRCm39) R282Q possibly damaging Het
Xrn1 A T 9: 95,846,118 (GRCm39) D57V probably benign Het
Zfp831 T C 2: 174,486,357 (GRCm39) V344A probably benign Het
Other mutations in Setd1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02508:Setd1a APN 7 127,396,870 (GRCm39) unclassified probably benign
IGL02657:Setd1a APN 7 127,394,997 (GRCm39) unclassified probably benign
IGL02792:Setd1a APN 7 127,390,522 (GRCm39) missense unknown
IGL02876:Setd1a APN 7 127,377,673 (GRCm39) splice site probably benign
IGL02967:Setd1a APN 7 127,384,349 (GRCm39) unclassified probably benign
IGL03090:Setd1a APN 7 127,385,672 (GRCm39) missense possibly damaging 0.83
IGL03238:Setd1a APN 7 127,384,718 (GRCm39) missense possibly damaging 0.86
FR4449:Setd1a UTSW 7 127,384,498 (GRCm39) unclassified probably benign
FR4548:Setd1a UTSW 7 127,384,485 (GRCm39) unclassified probably benign
FR4548:Setd1a UTSW 7 127,384,479 (GRCm39) unclassified probably benign
FR4589:Setd1a UTSW 7 127,384,469 (GRCm39) unclassified probably benign
FR4737:Setd1a UTSW 7 127,384,484 (GRCm39) unclassified probably benign
FR4976:Setd1a UTSW 7 127,384,488 (GRCm39) unclassified probably benign
FR4976:Setd1a UTSW 7 127,384,479 (GRCm39) unclassified probably benign
R0367:Setd1a UTSW 7 127,387,358 (GRCm39) splice site probably benign
R0411:Setd1a UTSW 7 127,395,223 (GRCm39) unclassified probably benign
R0416:Setd1a UTSW 7 127,384,469 (GRCm39) unclassified probably benign
R0470:Setd1a UTSW 7 127,384,229 (GRCm39) unclassified probably benign
R0645:Setd1a UTSW 7 127,386,382 (GRCm39) missense probably damaging 0.96
R0667:Setd1a UTSW 7 127,385,765 (GRCm39) missense probably damaging 0.99
R1251:Setd1a UTSW 7 127,396,596 (GRCm39) unclassified probably benign
R1465:Setd1a UTSW 7 127,387,512 (GRCm39) unclassified probably benign
R1465:Setd1a UTSW 7 127,387,512 (GRCm39) unclassified probably benign
R1660:Setd1a UTSW 7 127,395,841 (GRCm39) unclassified probably benign
R1730:Setd1a UTSW 7 127,384,296 (GRCm39) nonsense probably null
R1760:Setd1a UTSW 7 127,385,062 (GRCm39) missense possibly damaging 0.68
R1783:Setd1a UTSW 7 127,384,296 (GRCm39) nonsense probably null
R2149:Setd1a UTSW 7 127,385,690 (GRCm39) missense possibly damaging 0.75
R2159:Setd1a UTSW 7 127,384,661 (GRCm39) missense possibly damaging 0.91
R2303:Setd1a UTSW 7 127,398,327 (GRCm39) unclassified probably benign
R2679:Setd1a UTSW 7 127,394,896 (GRCm39) unclassified probably benign
R3428:Setd1a UTSW 7 127,384,493 (GRCm39) unclassified probably benign
R4108:Setd1a UTSW 7 127,398,374 (GRCm39) unclassified probably benign
R4227:Setd1a UTSW 7 127,395,819 (GRCm39) unclassified probably benign
R4438:Setd1a UTSW 7 127,384,903 (GRCm39) missense possibly damaging 0.83
R4730:Setd1a UTSW 7 127,396,502 (GRCm39) unclassified probably benign
R4869:Setd1a UTSW 7 127,396,776 (GRCm39) unclassified probably benign
R4892:Setd1a UTSW 7 127,377,696 (GRCm39) missense probably damaging 0.99
R5502:Setd1a UTSW 7 127,396,420 (GRCm39) critical splice donor site probably null
R5527:Setd1a UTSW 7 127,384,801 (GRCm39) missense probably damaging 0.99
R6189:Setd1a UTSW 7 127,377,455 (GRCm39) splice site probably null
R6250:Setd1a UTSW 7 127,390,471 (GRCm39) missense unknown
R7131:Setd1a UTSW 7 127,395,590 (GRCm39) small deletion probably benign
R7988:Setd1a UTSW 7 127,385,366 (GRCm39) missense probably benign 0.02
R8029:Setd1a UTSW 7 127,385,386 (GRCm39) missense probably benign 0.08
R8079:Setd1a UTSW 7 127,384,225 (GRCm39) missense unknown
R8171:Setd1a UTSW 7 127,390,399 (GRCm39) missense unknown
R8175:Setd1a UTSW 7 127,395,415 (GRCm39) missense unknown
R8286:Setd1a UTSW 7 127,385,356 (GRCm39) missense possibly damaging 0.96
R8327:Setd1a UTSW 7 127,390,669 (GRCm39) missense unknown
R8460:Setd1a UTSW 7 127,383,292 (GRCm39) missense unknown
R8547:Setd1a UTSW 7 127,395,676 (GRCm39) unclassified probably benign
R8699:Setd1a UTSW 7 127,385,774 (GRCm39) missense possibly damaging 0.53
R8822:Setd1a UTSW 7 127,385,332 (GRCm39) missense possibly damaging 0.86
R8968:Setd1a UTSW 7 127,385,279 (GRCm39) missense possibly damaging 0.93
R9063:Setd1a UTSW 7 127,385,558 (GRCm39) missense possibly damaging 0.91
R9178:Setd1a UTSW 7 127,385,590 (GRCm39) missense possibly damaging 0.93
R9672:Setd1a UTSW 7 127,385,237 (GRCm39) missense possibly damaging 0.96
R9700:Setd1a UTSW 7 127,385,752 (GRCm39) missense possibly damaging 0.53
RF001:Setd1a UTSW 7 127,384,486 (GRCm39) unclassified probably benign
RF008:Setd1a UTSW 7 127,384,486 (GRCm39) unclassified probably benign
RF011:Setd1a UTSW 7 127,384,515 (GRCm39) unclassified probably benign
RF014:Setd1a UTSW 7 127,384,518 (GRCm39) unclassified probably benign
RF030:Setd1a UTSW 7 127,384,483 (GRCm39) unclassified probably benign
RF030:Setd1a UTSW 7 127,384,473 (GRCm39) unclassified probably benign
RF031:Setd1a UTSW 7 127,384,483 (GRCm39) unclassified probably benign
RF036:Setd1a UTSW 7 127,384,472 (GRCm39) unclassified probably benign
RF041:Setd1a UTSW 7 127,384,504 (GRCm39) unclassified probably benign
RF052:Setd1a UTSW 7 127,384,529 (GRCm39) unclassified probably benign
RF055:Setd1a UTSW 7 127,384,471 (GRCm39) unclassified probably benign
RF056:Setd1a UTSW 7 127,384,500 (GRCm39) unclassified probably benign
RF056:Setd1a UTSW 7 127,384,475 (GRCm39) unclassified probably benign
RF058:Setd1a UTSW 7 127,384,490 (GRCm39) unclassified probably benign
Z1176:Setd1a UTSW 7 127,398,266 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- AAGAGCCATTTGGGAAGGCC -3'
(R):5'- TTTTCCATACCTGCTGGAGTAG -3'

Sequencing Primer
(F):5'- GCCCTGAAGTCCCCTATTAAGTATAG -3'
(R):5'- CTGCTGGAGTAGGCAGAGTC -3'
Posted On 2016-06-21