Incidental Mutation 'R0449:Dtnb'
ID39545
Institutional Source Beutler Lab
Gene Symbol Dtnb
Ensembl Gene ENSMUSG00000071454
Gene Namedystrobrevin, beta
Synonyms
MMRRC Submission 038649-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0449 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location3572381-3781796 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 3591971 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 45 (Q45*)
Ref Sequence ENSEMBL: ENSMUSP00000134146 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077930] [ENSMUST00000101637] [ENSMUST00000164578] [ENSMUST00000164607] [ENSMUST00000173199] [ENSMUST00000173240] [ENSMUST00000173483] [ENSMUST00000173736] [ENSMUST00000173998] [ENSMUST00000174109] [ENSMUST00000174290] [ENSMUST00000174479] [ENSMUST00000174547] [ENSMUST00000174639] [ENSMUST00000174663]
Predicted Effect probably null
Transcript: ENSMUST00000077930
AA Change: Q45*
SMART Domains Protein: ENSMUSP00000077085
Gene: ENSMUSG00000071454
AA Change: Q45*

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 140 1.7e-40 PFAM
Pfam:EF-hand_3 144 232 1.1e-38 PFAM
ZnF_ZZ 237 282 3.29e-15 SMART
low complexity region 403 416 N/A INTRINSIC
coiled coil region 429 519 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000101637
AA Change: Q45*
SMART Domains Protein: ENSMUSP00000099161
Gene: ENSMUSG00000071454
AA Change: Q45*

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 140 1.8e-40 PFAM
Pfam:EF-hand_3 144 232 1.1e-38 PFAM
ZnF_ZZ 237 282 3.29e-15 SMART
SCOP:d1eq1a_ 364 524 8e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000164578
AA Change: Q45*
SMART Domains Protein: ENSMUSP00000126194
Gene: ENSMUSG00000071454
AA Change: Q45*

DomainStartEndE-ValueType
Pfam:EF-hand_2 16 140 7.9e-38 PFAM
Pfam:EF-hand_3 144 232 2.1e-33 PFAM
ZnF_ZZ 237 282 3.29e-15 SMART
low complexity region 403 416 N/A INTRINSIC
coiled coil region 429 519 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000164607
AA Change: Q45*
SMART Domains Protein: ENSMUSP00000128230
Gene: ENSMUSG00000071454
AA Change: Q45*

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 140 2.1e-40 PFAM
Pfam:EF-hand_3 144 232 1.5e-38 PFAM
ZnF_ZZ 237 282 3.29e-15 SMART
low complexity region 403 416 N/A INTRINSIC
coiled coil region 429 519 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168806
Predicted Effect probably null
Transcript: ENSMUST00000173199
AA Change: Q45*
SMART Domains Protein: ENSMUSP00000134392
Gene: ENSMUSG00000071454
AA Change: Q45*

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 140 2e-40 PFAM
Pfam:EF-hand_3 144 232 1.6e-38 PFAM
ZnF_ZZ 237 282 3.29e-15 SMART
SCOP:d1eq1a_ 364 524 9e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000173240
AA Change: Q45*
SMART Domains Protein: ENSMUSP00000133722
Gene: ENSMUSG00000071454
AA Change: Q45*

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 140 1.8e-40 PFAM
Pfam:EF-hand_3 144 232 1.3e-38 PFAM
ZnF_ZZ 237 282 3.29e-15 SMART
low complexity region 373 386 N/A INTRINSIC
SCOP:d1eq1a_ 404 494 8e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000173483
AA Change: Q45*
SMART Domains Protein: ENSMUSP00000134390
Gene: ENSMUSG00000071454
AA Change: Q45*

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 61 7.9e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173524
Predicted Effect probably null
Transcript: ENSMUST00000173736
AA Change: Q45*
SMART Domains Protein: ENSMUSP00000134519
Gene: ENSMUSG00000071454
AA Change: Q45*

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 140 1.8e-40 PFAM
Pfam:EF-hand_3 144 232 1.3e-38 PFAM
ZnF_ZZ 237 282 3.29e-15 SMART
low complexity region 373 386 N/A INTRINSIC
coiled coil region 399 489 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173998
SMART Domains Protein: ENSMUSP00000133774
Gene: ENSMUSG00000071454

DomainStartEndE-ValueType
Pfam:EF-hand_2 11 90 3.3e-15 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000174109
AA Change: Q45*
SMART Domains Protein: ENSMUSP00000134151
Gene: ENSMUSG00000071454
AA Change: Q45*

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 132 1.1e-34 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000174290
AA Change: Q45*
SMART Domains Protein: ENSMUSP00000133697
Gene: ENSMUSG00000071454
AA Change: Q45*

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 140 6e-42 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000174479
AA Change: Q45*
SMART Domains Protein: ENSMUSP00000133702
Gene: ENSMUSG00000071454
AA Change: Q45*

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 140 3.9e-41 PFAM
Pfam:EF-hand_3 144 232 3.5e-39 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000174547
AA Change: Q45*
SMART Domains Protein: ENSMUSP00000133927
Gene: ENSMUSG00000071454
AA Change: Q45*

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 140 2e-40 PFAM
Pfam:EF-hand_3 144 232 1.4e-38 PFAM
ZnF_ZZ 237 282 3.29e-15 SMART
SCOP:d1eq1a_ 364 524 5e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000174639
AA Change: Q45*
SMART Domains Protein: ENSMUSP00000133601
Gene: ENSMUSG00000071454
AA Change: Q45*

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 123 6.9e-35 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000174663
AA Change: Q45*
SMART Domains Protein: ENSMUSP00000134146
Gene: ENSMUSG00000071454
AA Change: Q45*

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 140 2.2e-40 PFAM
Pfam:EF-hand_3 144 232 1.5e-38 PFAM
ZnF_ZZ 237 282 3.29e-15 SMART
SCOP:d1eq1a_ 364 524 4e-4 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes dystrobrevin beta, a component of the dystrophin-associated protein complex (DPC). The DPC consists of dystrophin and several integral and peripheral membrane proteins, including dystroglycans, sarcoglycans, syntrophins and dystrobrevin alpha and beta. The DPC localizes to the sarcolemma and its disruption is associated with various forms of muscular dystrophy. Dystrobrevin beta is thought to interact with syntrophin and the DP71 short form of dystrophin. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and show no obvious histological or functional abnormalities in liver and kidney. Mice homozygous for a gene trapped allele are viable, fertile and overtly normal with no significant synaptic or behavioral defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 A T 5: 8,939,885 R813* probably null Het
Accsl T A 2: 93,866,074 I60F probably benign Het
Adam29 C T 8: 55,872,681 G246D probably benign Het
Ankrd13c A G 3: 157,991,714 I319V probably benign Het
B020004J07Rik T C 4: 101,836,961 S242G probably benign Het
Bag6 T G 17: 35,141,466 V327G probably damaging Het
Barhl1 C T 2: 28,915,292 A130T probably benign Het
Bend4 T C 5: 67,398,240 D541G probably damaging Het
Birc6 A C 17: 74,692,295 T4673P probably damaging Het
Ccdc81 T C 7: 89,890,471 R186G probably damaging Het
Cdyl2 A G 8: 116,583,192 F342L probably damaging Het
Chd3 C A 11: 69,357,541 V748L probably damaging Het
CN725425 G T 15: 91,238,944 R72I possibly damaging Het
Col22a1 A G 15: 71,962,671 probably null Het
Cops3 A G 11: 59,818,417 probably null Het
Ctnnd1 G T 2: 84,603,262 Q940K possibly damaging Het
Efr3a T A 15: 65,842,704 I280K probably damaging Het
Eml6 A C 11: 29,893,213 V167G probably benign Het
Fam83c T A 2: 155,830,295 M407L probably benign Het
Fasn T C 11: 120,811,068 T1862A probably benign Het
Fbxl6 A G 15: 76,535,955 I486T probably damaging Het
Gpr182 A G 10: 127,750,696 Y129H probably damaging Het
Gpr75 A G 11: 30,892,456 S454G probably damaging Het
Hectd4 G A 5: 121,364,590 probably null Het
Hsf4 A G 8: 105,275,590 T411A probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Il4 A T 11: 53,618,605 M1K probably null Het
Ints11 G T 4: 155,887,948 R463L probably benign Het
Ints4 G A 7: 97,529,223 E677K probably damaging Het
Klk1b11 G A 7: 43,997,792 C50Y probably damaging Het
Krt14 C A 11: 100,207,395 G21C unknown Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
L3mbtl2 C T 15: 81,668,741 A125V probably damaging Het
Lama3 A G 18: 12,500,512 probably null Het
Lrrk2 T C 15: 91,750,275 L1414P probably damaging Het
Matn2 T C 15: 34,428,541 S684P probably damaging Het
Mga T A 2: 119,941,381 V1574D probably damaging Het
Mia2 T C 12: 59,172,594 probably null Het
Mrpl21 T A 19: 3,292,459 probably benign Het
Msh5 T A 17: 35,041,482 Q266L probably benign Het
Mybpc1 C A 10: 88,540,960 C758F probably damaging Het
Myo15 G A 11: 60,509,596 A2932T possibly damaging Het
Nbas T A 12: 13,519,108 I2021K probably benign Het
Neurl4 T C 11: 69,905,567 S424P probably damaging Het
Olfr16 T A 1: 172,957,398 V201E probably damaging Het
Olfr322 A C 11: 58,665,963 I135L probably benign Het
Olfr782 A G 10: 129,351,234 M224V probably benign Het
Olfr829 T C 9: 18,856,649 M8T probably benign Het
Olfr850 T A 9: 19,478,092 I53F possibly damaging Het
Phlpp1 C T 1: 106,350,578 R907W probably damaging Het
Pigg T C 5: 108,336,411 V508A probably benign Het
Pkhd1l1 T G 15: 44,501,519 Y685D probably damaging Het
Polr3a A T 14: 24,484,466 I34N probably damaging Het
Prex1 A G 2: 166,569,377 V1434A probably benign Het
Ptprh T A 7: 4,598,006 D124V probably damaging Het
Rad54b T A 4: 11,606,131 I513N probably benign Het
Rbm12b1 A G 4: 12,145,507 N493S probably benign Het
Rfx7 A T 9: 72,610,304 probably null Het
Serpini1 A G 3: 75,613,341 K82E probably benign Het
Slc27a6 T G 18: 58,609,165 probably null Het
Slc35f2 G T 9: 53,816,917 L358F probably damaging Het
Slc45a1 A C 4: 150,643,305 I158M probably damaging Het
Slurp2 G A 15: 74,743,106 P62L probably damaging Het
Sspo C T 6: 48,466,740 H1949Y probably damaging Het
Tiam1 A T 16: 89,837,827 V865E possibly damaging Het
Tlr4 A C 4: 66,839,620 I217L probably damaging Het
Top1 C T 2: 160,712,708 R460* probably null Het
Trpm3 T A 19: 22,988,054 S1638T probably benign Het
Tubgcp5 C T 7: 55,823,567 R798C probably benign Het
Vars T G 17: 35,012,727 probably null Het
Xylt2 A G 11: 94,666,333 Y111H probably benign Het
Zbed5 G A 5: 129,901,726 G172D probably damaging Het
Zfp53 C T 17: 21,508,833 T376I probably benign Het
Zfp937 G T 2: 150,239,546 V499L probably benign Het
Zyx T A 6: 42,351,313 L152Q probably damaging Het
Other mutations in Dtnb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01866:Dtnb APN 12 3732626 missense probably benign 0.00
IGL02269:Dtnb APN 12 3596691 missense probably damaging 1.00
IGL02710:Dtnb APN 12 3648380 missense possibly damaging 0.93
R0004:Dtnb UTSW 12 3596635 splice site probably benign
R0601:Dtnb UTSW 12 3735039 splice site probably benign
R1242:Dtnb UTSW 12 3732627 nonsense probably null
R1582:Dtnb UTSW 12 3773554 missense possibly damaging 0.78
R1719:Dtnb UTSW 12 3643936 nonsense probably null
R1960:Dtnb UTSW 12 3781190 missense probably benign 0.34
R2073:Dtnb UTSW 12 3781273 missense probably benign
R2074:Dtnb UTSW 12 3781273 missense probably benign
R3423:Dtnb UTSW 12 3591962 nonsense probably null
R3708:Dtnb UTSW 12 3589156 splice site probably null
R4788:Dtnb UTSW 12 3772699 missense probably damaging 1.00
R4816:Dtnb UTSW 12 3749505 missense probably damaging 0.99
R5086:Dtnb UTSW 12 3632942 missense probably benign 0.19
R5725:Dtnb UTSW 12 3773566 missense probably damaging 1.00
R6724:Dtnb UTSW 12 3686817 missense probably damaging 1.00
R6835:Dtnb UTSW 12 3632841 intron probably benign
R6912:Dtnb UTSW 12 3648221 critical splice acceptor site probably null
R7078:Dtnb UTSW 12 3748480 missense possibly damaging 0.80
R7105:Dtnb UTSW 12 3648391 critical splice donor site probably null
R7408:Dtnb UTSW 12 3644272 splice site probably null
R7538:Dtnb UTSW 12 3773611 missense possibly damaging 0.80
R8239:Dtnb UTSW 12 3644056 missense unknown
X0026:Dtnb UTSW 12 3686814 missense probably damaging 1.00
X0060:Dtnb UTSW 12 3596690 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCTTGCTTAGCAGAAGGCAAAACT -3'
(R):5'- GGTCATCTCAGAACCTGTCACTAATCAC -3'

Sequencing Primer
(F):5'- TGGCAGCATCTTGGCGG -3'
(R):5'- actgctcttccacacgac -3'
Posted On2013-05-23