Incidental Mutation 'R5152:Olfr935'
ID395452
Institutional Source Beutler Lab
Gene Symbol Olfr935
Ensembl Gene ENSMUSG00000059595
Gene Nameolfactory receptor 935
SynonymsGA_x6K02T2PVTD-32691280-32690354, MOR171-11
MMRRC Submission 042734-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R5152 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location38993971-38999683 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 38995177 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 86 (V86E)
Ref Sequence ENSEMBL: ENSMUSP00000149193 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080748] [ENSMUST00000214157]
Predicted Effect possibly damaging
Transcript: ENSMUST00000080748
AA Change: V86E

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000079572
Gene: ENSMUSG00000059595
AA Change: V86E

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 4e-53 PFAM
Pfam:7tm_1 41 290 1.2e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214157
AA Change: V86E

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
Meta Mutation Damage Score 0.0952 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T C 7: 120,540,623 S1503P probably benign Het
Actn3 C A 19: 4,863,544 V620F probably damaging Het
Adamtsl3 A G 7: 82,574,544 K252E probably benign Het
Adgrg1 A G 8: 95,009,745 Y509C probably damaging Het
Arhgef2 G A 3: 88,629,568 probably null Het
Bod1l T C 5: 41,816,543 E2476G probably benign Het
C130026I21Rik G A 1: 85,261,860 P19S probably benign Het
Capn3 T C 2: 120,501,330 probably benign Het
Catsperz T C 19: 6,923,337 T147A probably benign Het
Cc2d1b C A 4: 108,626,086 A289E probably benign Het
Ccdc170 A C 10: 4,561,107 H722P probably damaging Het
Cdk13 C A 13: 17,718,525 A1358S probably benign Het
Cntn6 T A 6: 104,569,113 probably benign Het
Coch A G 12: 51,595,442 N66D probably benign Het
Col12a1 A G 9: 79,656,748 S1732P probably damaging Het
Copa T A 1: 172,118,061 V917E probably benign Het
Csmd2 C A 4: 128,552,035 N3299K probably benign Het
Cyp2c67 A T 19: 39,638,688 F233I probably benign Het
D630039A03Rik T A 4: 57,910,434 H126L probably damaging Het
Ddx46 T C 13: 55,659,030 L492P probably damaging Het
Dpysl3 C T 18: 43,438,080 G43D probably benign Het
Enpp5 C T 17: 44,081,133 P151L probably damaging Het
Exoc3l4 T C 12: 111,430,893 probably benign Het
Faap100 T A 11: 120,377,632 E105V possibly damaging Het
Flg2 C A 3: 93,214,977 P1485T unknown Het
Fmo5 A G 3: 97,641,762 Y242C probably benign Het
Fsip2 C A 2: 82,978,572 T1745N probably benign Het
Gata4 T A 14: 63,241,121 N10Y probably damaging Het
Gm10722 A C 9: 3,001,041 Y39S probably benign Het
Gm4787 A C 12: 81,378,677 S236A probably benign Het
Gm9125 T C 3: 94,050,144 probably benign Het
Golga7 A C 8: 23,245,949 S94A probably benign Het
Gpbp1 A G 13: 111,453,281 probably benign Het
Grm1 A G 10: 11,079,875 Y222H probably benign Het
Gstcd A G 3: 133,084,956 Y17H possibly damaging Het
Hephl1 C A 9: 15,080,185 D586Y probably damaging Het
Hpn C A 7: 31,099,836 V35L probably damaging Het
Il23r T A 6: 67,423,741 N535I probably damaging Het
Inpp4a T C 1: 37,358,535 I45T possibly damaging Het
Itgae G C 11: 73,130,995 G901R probably damaging Het
Kif28 T C 1: 179,702,538 D686G probably damaging Het
Kit A G 5: 75,620,847 E312G probably benign Het
Lamb2 C A 9: 108,487,738 S1230R probably benign Het
Lars A T 18: 42,228,777 D588E possibly damaging Het
Lgr4 T A 2: 110,000,603 F292I probably damaging Het
Lmf1 C T 17: 25,655,519 S458L probably damaging Het
Lpin2 T A 17: 71,245,159 C787S probably damaging Het
Ms4a4a A C 19: 11,388,312 I138L probably benign Het
Mterf1a A T 5: 3,890,984 F295I probably damaging Het
Muc4 A T 16: 32,757,058 K241* probably null Het
Muc5b T C 7: 141,865,531 F4017S possibly damaging Het
Nfkbil1 T C 17: 35,221,408 probably benign Het
Olfr1269 A G 2: 90,119,121 L159P probably damaging Het
Olfr976 T C 9: 39,956,906 T22A probably benign Het
Osgep T C 14: 50,917,858 D81G probably damaging Het
Otos A G 1: 92,644,394 F70S probably damaging Het
Pcdhb2 T A 18: 37,296,126 V384D probably damaging Het
Ppp1r10 C T 17: 35,929,252 P514S probably damaging Het
Pramef17 G A 4: 143,994,260 P37L probably damaging Het
Prdm16 A G 4: 154,346,102 Y309H probably damaging Het
Rap1gds1 A T 3: 138,956,201 D382E probably damaging Het
Reln A G 5: 21,948,629 F2226L probably damaging Het
Rmi2 C T 16: 10,839,901 T125M probably damaging Het
Setd1a C T 7: 127,784,025 T231I probably benign Het
Sftpa1 G A 14: 41,134,352 G218D probably damaging Het
Shcbp1 A T 8: 4,736,138 F655I probably damaging Het
Slc5a7 T C 17: 54,278,833 I319V possibly damaging Het
Spata31d1c C T 13: 65,035,595 T317I probably damaging Het
Speg C T 1: 75,428,098 P2845S possibly damaging Het
Synpo2 A G 3: 123,235,901 probably null Het
Tdrd7 T A 4: 46,013,191 S644T probably damaging Het
Tmem182 T A 1: 40,838,300 Y112N probably damaging Het
Usp45 T A 4: 21,824,815 N522K probably benign Het
Vnn3 A T 10: 23,864,339 Y180F probably benign Het
Wnk1 C T 6: 120,002,280 R282Q possibly damaging Het
Xrn1 A T 9: 95,964,065 D57V probably benign Het
Zfp831 T C 2: 174,644,564 V344A probably benign Het
Other mutations in Olfr935
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01522:Olfr935 APN 9 38995100 missense probably benign 0.08
IGL01671:Olfr935 APN 9 38994853 missense probably benign 0.05
IGL02331:Olfr935 APN 9 38995106 missense probably damaging 0.99
IGL03069:Olfr935 APN 9 38995432 start codon destroyed probably null 0.98
IGL03143:Olfr935 APN 9 38995436 utr 5 prime probably benign
R0149:Olfr935 UTSW 9 38994584 missense probably benign 0.05
R0400:Olfr935 UTSW 9 38995198 missense probably damaging 1.00
R1818:Olfr935 UTSW 9 38994606 missense possibly damaging 0.61
R2092:Olfr935 UTSW 9 38995189 missense probably damaging 1.00
R2151:Olfr935 UTSW 9 38994716 missense probably damaging 1.00
R2166:Olfr935 UTSW 9 38995217 nonsense probably null
R2347:Olfr935 UTSW 9 38994509 makesense probably null
R4404:Olfr935 UTSW 9 38994569 missense possibly damaging 0.77
R4406:Olfr935 UTSW 9 38994569 missense possibly damaging 0.77
R5467:Olfr935 UTSW 9 38994904 missense probably benign 0.14
R5509:Olfr935 UTSW 9 38994628 missense probably benign 0.03
R5954:Olfr935 UTSW 9 38995415 missense probably damaging 1.00
R6647:Olfr935 UTSW 9 38994914 missense possibly damaging 0.55
R6680:Olfr935 UTSW 9 38994658 missense probably damaging 1.00
R6928:Olfr935 UTSW 9 38994632 missense probably benign 0.03
R7242:Olfr935 UTSW 9 38995141 missense probably benign 0.31
R7271:Olfr935 UTSW 9 38994657 nonsense probably null
R7309:Olfr935 UTSW 9 38995280 missense probably damaging 1.00
R7775:Olfr935 UTSW 9 38994907 missense probably damaging 1.00
R7778:Olfr935 UTSW 9 38994907 missense probably damaging 1.00
R7866:Olfr935 UTSW 9 38994731 missense not run
R8280:Olfr935 UTSW 9 38994779 missense probably benign
R8334:Olfr935 UTSW 9 38994593 missense probably benign 0.00
R8841:Olfr935 UTSW 9 38994583 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GCTGATGCACAAACTATGCC -3'
(R):5'- AACTACAGCTGCCACTCTTC -3'

Sequencing Primer
(F):5'- CTGATGCACAAACTATGCCTATAATG -3'
(R):5'- CCTCCTCTTTCTTGGAATCTACCTG -3'
Posted On2016-06-21