Incidental Mutation 'R5152:Grm1'
ID395458
Institutional Source Beutler Lab
Gene Symbol Grm1
Ensembl Gene ENSMUSG00000019828
Gene Nameglutamate receptor, metabotropic 1
SynonymsGrm1, Gprc1a, mGluR1, nmf373, rcw, 4930455H15Rik
MMRRC Submission 042734-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R5152 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location10686059-11082356 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 11079875 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 222 (Y222H)
Ref Sequence ENSEMBL: ENSMUSP00000101190 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044306] [ENSMUST00000105560] [ENSMUST00000105561]
Predicted Effect probably benign
Transcript: ENSMUST00000044306
AA Change: Y222H

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000037255
Gene: ENSMUSG00000019828
AA Change: Y222H

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 77 485 1.1e-94 PFAM
Pfam:Peripla_BP_6 151 340 1.4e-10 PFAM
Pfam:NCD3G 521 571 5.5e-16 PFAM
Pfam:7tm_3 604 837 2.4e-55 PFAM
low complexity region 969 975 N/A INTRINSIC
low complexity region 983 993 N/A INTRINSIC
low complexity region 1013 1033 N/A INTRINSIC
low complexity region 1071 1088 N/A INTRINSIC
low complexity region 1093 1109 N/A INTRINSIC
low complexity region 1126 1136 N/A INTRINSIC
GluR_Homer-bdg 1149 1199 6.85e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105560
AA Change: Y222H

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000101189
Gene: ENSMUSG00000019828
AA Change: Y222H

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 77 485 2e-92 PFAM
Pfam:Peripla_BP_6 152 347 2.7e-12 PFAM
Pfam:NCD3G 520 571 2.7e-19 PFAM
Pfam:7tm_3 602 838 3.2e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105561
AA Change: Y222H

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000101190
Gene: ENSMUSG00000019828
AA Change: Y222H

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 77 485 2e-92 PFAM
Pfam:Peripla_BP_6 152 347 2.7e-12 PFAM
Pfam:NCD3G 520 571 2.7e-19 PFAM
Pfam:7tm_3 602 838 3.2e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156826
Meta Mutation Damage Score 0.034 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a metabotropic glutamate receptor that functions by activating phospholipase C. L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The canonical alpha isoform of the encoded protein is a disulfide-linked homodimer whose activity is mediated by a G-protein-coupled phosphatidylinositol-calcium second messenger system. This gene may be associated with many disease states, including schizophrenia, bipolar disorder, depression, and breast cancer. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for null mutations show impairements in motor coordination, spatial learning, hippocampal mossy fiber long-term potentiation, and cerebellar long-term depression. Homozygotes for a spontaneous mutation are small and exhibit ataxia, kyphoscoliosis, albuminuria and glomerular damage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T C 7: 120,540,623 S1503P probably benign Het
Actn3 C A 19: 4,863,544 V620F probably damaging Het
Adamtsl3 A G 7: 82,574,544 K252E probably benign Het
Adgrg1 A G 8: 95,009,745 Y509C probably damaging Het
Arhgef2 G A 3: 88,629,568 probably null Het
Bod1l T C 5: 41,816,543 E2476G probably benign Het
C130026I21Rik G A 1: 85,261,860 P19S probably benign Het
Capn3 T C 2: 120,501,330 probably benign Het
Catsperz T C 19: 6,923,337 T147A probably benign Het
Cc2d1b C A 4: 108,626,086 A289E probably benign Het
Ccdc170 A C 10: 4,561,107 H722P probably damaging Het
Cdk13 C A 13: 17,718,525 A1358S probably benign Het
Cntn6 T A 6: 104,569,113 probably benign Het
Coch A G 12: 51,595,442 N66D probably benign Het
Col12a1 A G 9: 79,656,748 S1732P probably damaging Het
Copa T A 1: 172,118,061 V917E probably benign Het
Csmd2 C A 4: 128,552,035 N3299K probably benign Het
Cyp2c67 A T 19: 39,638,688 F233I probably benign Het
D630039A03Rik T A 4: 57,910,434 H126L probably damaging Het
Ddx46 T C 13: 55,659,030 L492P probably damaging Het
Dpysl3 C T 18: 43,438,080 G43D probably benign Het
Enpp5 C T 17: 44,081,133 P151L probably damaging Het
Exoc3l4 T C 12: 111,430,893 probably benign Het
Faap100 T A 11: 120,377,632 E105V possibly damaging Het
Flg2 C A 3: 93,214,977 P1485T unknown Het
Fmo5 A G 3: 97,641,762 Y242C probably benign Het
Fsip2 C A 2: 82,978,572 T1745N probably benign Het
Gata4 T A 14: 63,241,121 N10Y probably damaging Het
Gm10722 A C 9: 3,001,041 Y39S probably benign Het
Gm4787 A C 12: 81,378,677 S236A probably benign Het
Gm9125 T C 3: 94,050,144 probably benign Het
Golga7 A C 8: 23,245,949 S94A probably benign Het
Gpbp1 A G 13: 111,453,281 probably benign Het
Gstcd A G 3: 133,084,956 Y17H possibly damaging Het
Hephl1 C A 9: 15,080,185 D586Y probably damaging Het
Hpn C A 7: 31,099,836 V35L probably damaging Het
Il23r T A 6: 67,423,741 N535I probably damaging Het
Inpp4a T C 1: 37,358,535 I45T possibly damaging Het
Itgae G C 11: 73,130,995 G901R probably damaging Het
Kif28 T C 1: 179,702,538 D686G probably damaging Het
Kit A G 5: 75,620,847 E312G probably benign Het
Lamb2 C A 9: 108,487,738 S1230R probably benign Het
Lars A T 18: 42,228,777 D588E possibly damaging Het
Lgr4 T A 2: 110,000,603 F292I probably damaging Het
Lmf1 C T 17: 25,655,519 S458L probably damaging Het
Lpin2 T A 17: 71,245,159 C787S probably damaging Het
Ms4a4a A C 19: 11,388,312 I138L probably benign Het
Mterf1a A T 5: 3,890,984 F295I probably damaging Het
Muc4 A T 16: 32,757,058 K241* probably null Het
Muc5b T C 7: 141,865,531 F4017S possibly damaging Het
Nfkbil1 T C 17: 35,221,408 probably benign Het
Olfr1269 A G 2: 90,119,121 L159P probably damaging Het
Olfr935 A T 9: 38,995,177 V86E possibly damaging Het
Olfr976 T C 9: 39,956,906 T22A probably benign Het
Osgep T C 14: 50,917,858 D81G probably damaging Het
Otos A G 1: 92,644,394 F70S probably damaging Het
Pcdhb2 T A 18: 37,296,126 V384D probably damaging Het
Ppp1r10 C T 17: 35,929,252 P514S probably damaging Het
Pramef17 G A 4: 143,994,260 P37L probably damaging Het
Prdm16 A G 4: 154,346,102 Y309H probably damaging Het
Rap1gds1 A T 3: 138,956,201 D382E probably damaging Het
Reln A G 5: 21,948,629 F2226L probably damaging Het
Rmi2 C T 16: 10,839,901 T125M probably damaging Het
Setd1a C T 7: 127,784,025 T231I probably benign Het
Sftpa1 G A 14: 41,134,352 G218D probably damaging Het
Shcbp1 A T 8: 4,736,138 F655I probably damaging Het
Slc5a7 T C 17: 54,278,833 I319V possibly damaging Het
Spata31d1c C T 13: 65,035,595 T317I probably damaging Het
Speg C T 1: 75,428,098 P2845S possibly damaging Het
Synpo2 A G 3: 123,235,901 probably null Het
Tdrd7 T A 4: 46,013,191 S644T probably damaging Het
Tmem182 T A 1: 40,838,300 Y112N probably damaging Het
Usp45 T A 4: 21,824,815 N522K probably benign Het
Vnn3 A T 10: 23,864,339 Y180F probably benign Het
Wnk1 C T 6: 120,002,280 R282Q possibly damaging Het
Xrn1 A T 9: 95,964,065 D57V probably benign Het
Zfp831 T C 2: 174,644,564 V344A probably benign Het
Other mutations in Grm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01371:Grm1 APN 10 10720039 missense probably benign 0.01
IGL02078:Grm1 APN 10 10689610 missense probably benign 0.02
IGL02156:Grm1 APN 10 10719976 missense probably damaging 0.99
IGL02476:Grm1 APN 10 10689453 missense probably benign 0.29
IGL02498:Grm1 APN 10 10719979 missense probably damaging 1.00
IGL02621:Grm1 APN 10 10689011 nonsense probably null
IGL03192:Grm1 APN 10 11079916 missense possibly damaging 0.66
IGL03342:Grm1 APN 10 11079971 missense probably benign 0.08
dewey UTSW 10 10719595 missense probably damaging 1.00
dingus UTSW 10 10719967 missense probably benign 0.06
donald UTSW 10 10741508 nonsense probably null
jim UTSW 10 10719805 missense probably damaging 1.00
lightness UTSW 10 11079958 missense probably damaging 1.00
IGL02796:Grm1 UTSW 10 10689667 missense probably benign
R0294:Grm1 UTSW 10 11080399 missense probably damaging 1.00
R0525:Grm1 UTSW 10 10719209 splice site probably benign
R0554:Grm1 UTSW 10 10719923 missense probably benign 0.01
R1184:Grm1 UTSW 10 10720034 missense probably benign 0.40
R1319:Grm1 UTSW 10 10689398 missense probably benign 0.05
R1403:Grm1 UTSW 10 11080135 missense probably benign 0.00
R1403:Grm1 UTSW 10 11080135 missense probably benign 0.00
R1467:Grm1 UTSW 10 10719958 missense probably damaging 1.00
R1467:Grm1 UTSW 10 10719958 missense probably damaging 1.00
R1494:Grm1 UTSW 10 10689706 missense probably benign 0.04
R1589:Grm1 UTSW 10 10719967 missense probably benign 0.06
R1615:Grm1 UTSW 10 10741508 nonsense probably null
R1720:Grm1 UTSW 10 10746794 splice site probably null
R1738:Grm1 UTSW 10 10936419 missense probably damaging 1.00
R1763:Grm1 UTSW 10 11079866 missense possibly damaging 0.47
R1774:Grm1 UTSW 10 11079866 missense possibly damaging 0.47
R2041:Grm1 UTSW 10 10746603 missense probably damaging 0.98
R2092:Grm1 UTSW 10 10689225 missense probably benign 0.00
R2198:Grm1 UTSW 10 10782776 missense probably damaging 1.00
R2297:Grm1 UTSW 10 11080414 missense probably benign 0.03
R2333:Grm1 UTSW 10 10719346 missense probably damaging 0.98
R2333:Grm1 UTSW 10 10719619 missense probably benign 0.31
R2914:Grm1 UTSW 10 11079857 missense probably benign 0.07
R3105:Grm1 UTSW 10 11079857 missense probably benign 0.07
R3106:Grm1 UTSW 10 11079857 missense probably benign 0.07
R3705:Grm1 UTSW 10 10782729 missense possibly damaging 0.95
R3931:Grm1 UTSW 10 10719878 missense probably benign 0.44
R4810:Grm1 UTSW 10 10782694 missense probably damaging 1.00
R4892:Grm1 UTSW 10 10719587 missense possibly damaging 0.81
R4938:Grm1 UTSW 10 10936513 missense probably damaging 1.00
R4947:Grm1 UTSW 10 10782633 missense probably damaging 1.00
R4966:Grm1 UTSW 10 10719665 nonsense probably null
R5283:Grm1 UTSW 10 10733192 missense possibly damaging 0.70
R5317:Grm1 UTSW 10 10746699 missense possibly damaging 0.77
R5374:Grm1 UTSW 10 11080442 missense probably benign 0.14
R5428:Grm1 UTSW 10 10719563 missense probably damaging 1.00
R5604:Grm1 UTSW 10 10746735 missense probably damaging 1.00
R5894:Grm1 UTSW 10 11080255 missense probably damaging 1.00
R5896:Grm1 UTSW 10 11080550 utr 5 prime probably benign
R5899:Grm1 UTSW 10 10689348 missense probably benign
R6032:Grm1 UTSW 10 10719805 missense probably damaging 1.00
R6032:Grm1 UTSW 10 10719805 missense probably damaging 1.00
R6139:Grm1 UTSW 10 10746331 intron probably benign
R6144:Grm1 UTSW 10 11079896 missense probably benign 0.08
R6208:Grm1 UTSW 10 10719946 missense probably damaging 1.00
R6976:Grm1 UTSW 10 10689180 missense probably benign 0.00
R7027:Grm1 UTSW 10 10719595 missense probably damaging 1.00
R7079:Grm1 UTSW 10 11079958 missense probably damaging 1.00
R7286:Grm1 UTSW 10 10689696 missense probably benign 0.19
R7352:Grm1 UTSW 10 10719493 missense probably damaging 1.00
R7484:Grm1 UTSW 10 10746659 missense probably benign 0.06
X0002:Grm1 UTSW 10 10936513 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGAATGTGGTTTTACTGCAC -3'
(R):5'- CTGTGGCCATTCAAGTCCAG -3'

Sequencing Primer
(F):5'- ACTGCACTGTAATTATCGGGG -3'
(R):5'- GTGGCCATTCAAGTCCAGAATCTTC -3'
Posted On2016-06-21