Incidental Mutation 'R5153:Rassf6'
ID 395507
Institutional Source Beutler Lab
Gene Symbol Rassf6
Ensembl Gene ENSMUSG00000029370
Gene Name Ras association (RalGDS/AF-6) domain family member 6
Synonyms 1600016B17Rik
MMRRC Submission 042735-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.075) question?
Stock # R5153 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 90750935-90788516 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 90754699 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 206 (K206R)
Ref Sequence ENSEMBL: ENSMUSP00000144532 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031317] [ENSMUST00000202704] [ENSMUST00000202784]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000031317
AA Change: K206R

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000031317
Gene: ENSMUSG00000029370
AA Change: K206R

DomainStartEndE-ValueType
RA 188 278 2.67e-9 SMART
Pfam:Nore1-SARAH 290 329 1.1e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000202704
AA Change: K206R

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000144532
Gene: ENSMUSG00000029370
AA Change: K206R

DomainStartEndE-ValueType
RA 188 278 2.67e-9 SMART
Pfam:Nore1-SARAH 290 329 1.1e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000202784
AA Change: K193R

PolyPhen 2 Score 0.769 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000144337
Gene: ENSMUSG00000029370
AA Change: K193R

DomainStartEndE-ValueType
low complexity region 126 135 N/A INTRINSIC
RA 175 265 2.67e-9 SMART
Pfam:Nore1-SARAH 277 316 8.6e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202807
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ras-association domain family (RASSF). Members of this family form the core of a highly conserved tumor suppressor network, the Salvador-Warts-Hippo (SWH) pathway. The protein encoded by this gene is a Ras effector protein that induces apoptosis. A genomic region containing this gene has been linked to susceptibility to viral bronchiolitis. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik A T 11: 99,728,073 (GRCm39) C257S unknown Het
4930596D02Rik C A 14: 35,532,212 (GRCm39) R121L probably benign Het
Aadacl4fm1 T A 4: 144,248,837 (GRCm39) M68K probably benign Het
Acin1 A G 14: 54,883,070 (GRCm39) V194A probably benign Het
Acsm1 T C 7: 119,239,950 (GRCm39) I298T possibly damaging Het
Aoc1 A G 6: 48,885,681 (GRCm39) N729D probably benign Het
Apobr C T 7: 126,186,904 (GRCm39) T20I possibly damaging Het
Arsb A G 13: 94,077,106 (GRCm39) E491G probably benign Het
AW209491 C G 13: 14,811,764 (GRCm39) Q206E probably benign Het
Camsap1 A T 2: 25,823,630 (GRCm39) N1473K probably damaging Het
Casp8 A G 1: 58,884,004 (GRCm39) Q457R probably benign Het
Ccdc154 G A 17: 25,387,315 (GRCm39) A350T probably damaging Het
Cecr2 A G 6: 120,711,521 (GRCm39) E183G probably benign Het
Cep295 A T 9: 15,268,925 (GRCm39) S39T probably benign Het
Cep350 A T 1: 155,811,692 (GRCm39) I416K probably damaging Het
Cidea C T 18: 67,500,490 (GRCm39) T184M probably damaging Het
Cnot10 G A 9: 114,442,803 (GRCm39) A468V probably damaging Het
Cstdc1 A G 2: 148,625,360 (GRCm39) Q98R probably benign Het
Defb22 A T 2: 152,327,722 (GRCm39) N154K unknown Het
Dnah17 A T 11: 117,973,800 (GRCm39) C1915* probably null Het
Dnah2 T C 11: 69,411,759 (GRCm39) T288A possibly damaging Het
Dop1b T A 16: 93,570,891 (GRCm39) M1512K probably damaging Het
Dsp T G 13: 38,366,282 (GRCm39) I572S probably damaging Het
Eepd1 A G 9: 25,498,049 (GRCm39) H378R probably benign Het
Elapor1 A T 3: 108,380,063 (GRCm39) Y349N possibly damaging Het
Emilin2 A G 17: 71,580,497 (GRCm39) M743T possibly damaging Het
Ext1 C A 15: 52,939,213 (GRCm39) W612L probably damaging Het
F2rl2 A G 13: 95,833,620 (GRCm39) T17A probably benign Het
Fbxl8 T G 8: 105,993,739 (GRCm39) C32G probably damaging Het
Fbxw17 A G 13: 50,573,897 (GRCm39) T38A probably damaging Het
Flii A T 11: 60,607,512 (GRCm39) L882Q possibly damaging Het
Focad T G 4: 88,278,121 (GRCm39) S1197A unknown Het
H1f11-ps A G 19: 47,159,356 (GRCm39) V73A probably damaging Het
Heatr5b G A 17: 79,102,536 (GRCm39) R1281* probably null Het
Khdc3 A G 9: 73,010,720 (GRCm39) Q190R probably benign Het
Krt9 T A 11: 100,082,068 (GRCm39) D244V probably damaging Het
Ldhd T C 8: 112,353,724 (GRCm39) E463G probably benign Het
Lig4 A T 8: 10,023,003 (GRCm39) V259E possibly damaging Het
Luc7l3 A T 11: 94,186,806 (GRCm39) probably benign Het
Man1a2 T C 3: 100,563,579 (GRCm39) E22G probably damaging Het
Mmp23 T G 4: 155,735,797 (GRCm39) D258A probably damaging Het
Msantd2 C T 9: 37,434,509 (GRCm39) R250* probably null Het
Mynn T C 3: 30,665,738 (GRCm39) S457P probably benign Het
Nectin1 C T 9: 43,714,795 (GRCm39) H50Y probably damaging Het
Or10a3b T C 7: 108,444,906 (GRCm39) I104V probably benign Het
Or2d3c C T 7: 106,525,776 (GRCm39) V297M possibly damaging Het
Or4a47 G A 2: 89,665,578 (GRCm39) T237I possibly damaging Het
Or6c6c A G 10: 129,541,026 (GRCm39) N93S probably benign Het
Pfkfb2 G A 1: 130,629,527 (GRCm39) T303M probably damaging Het
Pkhd1l1 A G 15: 44,368,705 (GRCm39) D841G probably benign Het
Plxna4 A T 6: 32,201,094 (GRCm39) probably null Het
Podnl1 C T 8: 84,857,272 (GRCm39) H294Y probably benign Het
Ppig T A 2: 69,579,994 (GRCm39) D509E unknown Het
Ppp1r16a T A 15: 76,578,596 (GRCm39) Y433* probably null Het
Prdm1 A C 10: 44,326,221 (GRCm39) V134G possibly damaging Het
Prx T C 7: 27,217,901 (GRCm39) S940P probably damaging Het
Ptprd C T 4: 75,930,339 (GRCm39) V731I probably damaging Het
Qki A G 17: 10,457,820 (GRCm39) probably null Het
Rdh16f2 G A 10: 127,712,124 (GRCm39) E194K possibly damaging Het
Rims1 C A 1: 22,522,328 (GRCm39) G457* probably null Het
Ripk1 T G 13: 34,197,279 (GRCm39) I123R probably damaging Het
Rnf111 A T 9: 70,383,422 (GRCm39) S170R probably benign Het
Shc3 A T 13: 51,615,413 (GRCm39) F181L probably damaging Het
Siglec1 A C 2: 130,927,497 (GRCm39) V103G probably damaging Het
Slc26a11 G T 11: 119,268,085 (GRCm39) A488S possibly damaging Het
Smoc2 A T 17: 14,556,841 (GRCm39) T97S probably damaging Het
Son T C 16: 91,451,910 (GRCm39) I219T possibly damaging Het
Sptbn1 A T 11: 30,071,510 (GRCm39) I1474N possibly damaging Het
Syt16 A T 12: 74,269,542 (GRCm39) D127V possibly damaging Het
Tet1 G T 10: 62,714,357 (GRCm39) N479K possibly damaging Het
Thsd7a G A 6: 12,338,654 (GRCm39) A1192V probably benign Het
Tmed3 G A 9: 89,581,825 (GRCm39) R213* probably null Het
Traj57 A G 14: 54,396,016 (GRCm39) probably benign Het
Trpv1 G T 11: 73,129,342 (GRCm39) R86S probably benign Het
Usp48 T A 4: 137,343,673 (GRCm39) F434L possibly damaging Het
Vmn2r59 A C 7: 41,691,834 (GRCm39) probably null Het
Vmn2r71 T A 7: 85,268,430 (GRCm39) I211N possibly damaging Het
Vps13b T A 15: 35,422,599 (GRCm39) D186E probably damaging Het
Vps33a A G 5: 123,696,691 (GRCm39) S321P probably damaging Het
Wdr12 A T 1: 60,133,670 (GRCm39) D19E probably benign Het
Zc3h12c A G 9: 52,037,947 (GRCm39) F278L probably damaging Het
Zpld1 T C 16: 55,067,007 (GRCm39) T183A probably damaging Het
Zswim2 G T 2: 83,770,010 (GRCm39) T68K possibly damaging Het
Other mutations in Rassf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Rassf6 APN 5 90,751,999 (GRCm39) missense probably damaging 1.00
IGL00819:Rassf6 APN 5 90,751,930 (GRCm39) missense probably benign 0.03
IGL01139:Rassf6 APN 5 90,756,825 (GRCm39) makesense probably null
IGL03114:Rassf6 APN 5 90,756,649 (GRCm39) splice site probably benign
R1956:Rassf6 UTSW 5 90,763,730 (GRCm39) nonsense probably null
R2167:Rassf6 UTSW 5 90,751,797 (GRCm39) missense probably damaging 1.00
R2351:Rassf6 UTSW 5 90,779,418 (GRCm39) missense probably benign 0.05
R2877:Rassf6 UTSW 5 90,754,664 (GRCm39) missense probably damaging 1.00
R3943:Rassf6 UTSW 5 90,752,185 (GRCm39) missense possibly damaging 0.49
R3944:Rassf6 UTSW 5 90,752,185 (GRCm39) missense possibly damaging 0.49
R4131:Rassf6 UTSW 5 90,757,646 (GRCm39) missense probably damaging 1.00
R5134:Rassf6 UTSW 5 90,752,225 (GRCm39) critical splice acceptor site probably null
R5633:Rassf6 UTSW 5 90,751,977 (GRCm39) missense possibly damaging 0.84
R5994:Rassf6 UTSW 5 90,765,627 (GRCm39) missense probably damaging 1.00
R6000:Rassf6 UTSW 5 90,751,736 (GRCm39) missense probably damaging 1.00
R6746:Rassf6 UTSW 5 90,757,633 (GRCm39) missense possibly damaging 0.80
R7038:Rassf6 UTSW 5 90,757,584 (GRCm39) missense probably benign 0.13
R7190:Rassf6 UTSW 5 90,754,666 (GRCm39) missense probably damaging 1.00
R7549:Rassf6 UTSW 5 90,754,661 (GRCm39) missense probably damaging 1.00
R8497:Rassf6 UTSW 5 90,779,391 (GRCm39) missense possibly damaging 0.83
R9472:Rassf6 UTSW 5 90,765,572 (GRCm39) nonsense probably null
RF002:Rassf6 UTSW 5 90,756,784 (GRCm39) nonsense probably null
RF002:Rassf6 UTSW 5 90,756,780 (GRCm39) utr 3 prime probably benign
RF004:Rassf6 UTSW 5 90,756,778 (GRCm39) utr 3 prime probably benign
RF011:Rassf6 UTSW 5 90,756,780 (GRCm39) utr 3 prime probably benign
RF013:Rassf6 UTSW 5 90,756,800 (GRCm39) utr 3 prime probably benign
RF018:Rassf6 UTSW 5 90,756,788 (GRCm39) utr 3 prime probably benign
RF032:Rassf6 UTSW 5 90,756,798 (GRCm39) utr 3 prime probably benign
RF034:Rassf6 UTSW 5 90,756,776 (GRCm39) utr 3 prime probably benign
RF034:Rassf6 UTSW 5 90,756,771 (GRCm39) utr 3 prime probably benign
RF034:Rassf6 UTSW 5 90,756,782 (GRCm39) utr 3 prime probably benign
RF035:Rassf6 UTSW 5 90,756,767 (GRCm39) utr 3 prime probably benign
RF036:Rassf6 UTSW 5 90,756,774 (GRCm39) utr 3 prime probably benign
RF038:Rassf6 UTSW 5 90,756,789 (GRCm39) utr 3 prime probably benign
RF038:Rassf6 UTSW 5 90,756,783 (GRCm39) utr 3 prime probably benign
RF039:Rassf6 UTSW 5 90,756,798 (GRCm39) utr 3 prime probably benign
RF039:Rassf6 UTSW 5 90,756,774 (GRCm39) utr 3 prime probably benign
RF043:Rassf6 UTSW 5 90,756,798 (GRCm39) utr 3 prime probably benign
RF043:Rassf6 UTSW 5 90,756,791 (GRCm39) utr 3 prime probably benign
RF049:Rassf6 UTSW 5 90,756,772 (GRCm39) utr 3 prime probably benign
RF051:Rassf6 UTSW 5 90,756,788 (GRCm39) utr 3 prime probably benign
RF052:Rassf6 UTSW 5 90,756,782 (GRCm39) utr 3 prime probably benign
RF052:Rassf6 UTSW 5 90,756,775 (GRCm39) utr 3 prime probably benign
RF054:Rassf6 UTSW 5 90,756,790 (GRCm39) utr 3 prime probably benign
RF054:Rassf6 UTSW 5 90,756,783 (GRCm39) utr 3 prime probably benign
RF054:Rassf6 UTSW 5 90,756,770 (GRCm39) utr 3 prime probably benign
RF063:Rassf6 UTSW 5 90,756,801 (GRCm39) nonsense probably null
X0017:Rassf6 UTSW 5 90,754,648 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGATAATGTGAATTTCTGGGCTAC -3'
(R):5'- GACATCACAAGGAGTTGCATC -3'

Sequencing Primer
(F):5'- GAGGAAGTTCTCGTCCATCAAAGTTG -3'
(R):5'- CAAGGAGTTGCATCATCACTTC -3'
Posted On 2016-06-21