Mutagenetix > Incidental Mutation

Incidental Mutation 'R5153:Vps33a'

395509

Institutional Source

Beutler Lab

Gene Symbol

Vps33a

Ensembl Gene

ENSMUSG00000029434

Gene Name

VPS33A CORVET/HOPS core subunit

Synonyms

3830421M04Rik, bf

MMRRC Submission

042735-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5153 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

123528659-123573038 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 123558628 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 321 (S321P)

Ref Sequence

ENSEMBL: ENSMUSP00000031388 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031388]

AlphaFold

Q9D2N9

Predicted Effect

probably damaging
Transcript: ENSMUST00000031388
AA Change: S321P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000031388
Gene: ENSMUSG00000029434
AA Change: S321P

Domain	Start	End	E-Value	Type
low complexity region	12	27	N/A	INTRINSIC
Pfam:Sec1	34	592	7.2e-104	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197472

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000198900

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200325

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene is a member of the Sec-1 domain family, and it encodes a protein similar to the yeast class C Vps33 protein. The mammalian class C VPS proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene produce hypopigmentation, an extended bleeeding time and abnormal kidney function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2300003K06Rik	A	T	11: 99,837,247	C257S	unknown	Het
4930596D02Rik	C	A	14: 35,810,255	R121L	probably benign	Het
5330417C22Rik	A	T	3: 108,472,747	Y349N	possibly damaging	Het
8030411F24Rik	A	G	2: 148,783,440	Q98R	probably benign	Het
9430007A20Rik	T	A	4: 144,522,267	M68K	probably benign	Het
Acin1	A	G	14: 54,645,613	V194A	probably benign	Het
Acsm1	T	C	7: 119,640,727	I298T	possibly damaging	Het
Aoc1	A	G	6: 48,908,747	N729D	probably benign	Het
Apobr	C	T	7: 126,587,732	T20I	possibly damaging	Het
Arsb	A	G	13: 93,940,598	E491G	probably benign	Het
AW209491	C	G	13: 14,637,179	Q206E	probably benign	Het
Camsap1	A	T	2: 25,933,618	N1473K	probably damaging	Het
Casp8	A	G	1: 58,844,845	Q457R	probably benign	Het
Ccdc154	G	A	17: 25,168,341	A350T	probably damaging	Het
Cecr2	A	G	6: 120,734,560	E183G	probably benign	Het
Cep295	A	T	9: 15,357,629	S39T	probably benign	Het
Cep350	A	T	1: 155,935,946	I416K	probably damaging	Het
Cidea	C	T	18: 67,367,420	T184M	probably damaging	Het
Cnot10	G	A	9: 114,613,735	A468V	probably damaging	Het
Defb22	A	T	2: 152,485,802	N154K	unknown	Het
Dnah17	A	T	11: 118,082,974	C1915*	probably null	Het
Dnah2	T	C	11: 69,520,933	T288A	possibly damaging	Het
Dopey2	T	A	16: 93,774,003	M1512K	probably damaging	Het
Dsp	T	G	13: 38,182,306	I572S	probably damaging	Het
Eepd1	A	G	9: 25,586,753	H378R	probably benign	Het
Emilin2	A	G	17: 71,273,502	M743T	possibly damaging	Het
Ext1	C	A	15: 53,075,817	W612L	probably damaging	Het
F2rl2	A	G	13: 95,697,112	T17A	probably benign	Het
Fbxl8	T	G	8: 105,267,107	C32G	probably damaging	Het
Fbxw17	A	G	13: 50,419,861	T38A	probably damaging	Het
Flii	A	T	11: 60,716,686	L882Q	possibly damaging	Het
Focad	T	G	4: 88,359,884	S1197A	unknown	Het
Gm6970	A	G	19: 47,170,917	V73A	probably damaging	Het
Heatr5b	G	A	17: 78,795,107	R1281*	probably null	Het
Khdc3	A	G	9: 73,103,438	Q190R	probably benign	Het
Krt9	T	A	11: 100,191,242	D244V	probably damaging	Het
Ldhd	T	C	8: 111,627,092	E463G	probably benign	Het
Lig4	A	T	8: 9,973,003	V259E	possibly damaging	Het
Luc7l3	A	T	11: 94,295,980		probably benign	Het
Man1a2	T	C	3: 100,656,263	E22G	probably damaging	Het
Mmp23	T	G	4: 155,651,340	D258A	probably damaging	Het
Msantd2	C	T	9: 37,523,213	R250*	probably null	Het
Mynn	T	C	3: 30,611,589	S457P	probably benign	Het
Nectin1	C	T	9: 43,803,498	H50Y	probably damaging	Het
Olfr1256	G	A	2: 89,835,234	T237I	possibly damaging	Het
Olfr516	T	C	7: 108,845,699	I104V	probably benign	Het
Olfr709-ps1	C	T	7: 106,926,569	V297M	possibly damaging	Het
Olfr804	A	G	10: 129,705,157	N93S	probably benign	Het
Pfkfb2	G	A	1: 130,701,790	T303M	probably damaging	Het
Pkhd1l1	A	G	15: 44,505,309	D841G	probably benign	Het
Plxna4	A	T	6: 32,224,159		probably null	Het
Podnl1	C	T	8: 84,130,643	H294Y	probably benign	Het
Ppig	T	A	2: 69,749,650	D509E	unknown	Het
Ppp1r16a	T	A	15: 76,694,396	Y433*	probably null	Het
Prdm1	A	C	10: 44,450,225	V134G	possibly damaging	Het
Prx	T	C	7: 27,518,476	S940P	probably damaging	Het
Ptprd	C	T	4: 76,012,102	V731I	probably damaging	Het
Qk	A	G	17: 10,238,891		probably null	Het
Rassf6	T	C	5: 90,606,840	K206R	possibly damaging	Het
Rdh16f2	G	A	10: 127,876,255	E194K	possibly damaging	Het
Rims1	C	A	1: 22,483,247	G457*	probably null	Het
Ripk1	T	G	13: 34,013,296	I123R	probably damaging	Het
Rnf111	A	T	9: 70,476,140	S170R	probably benign	Het
Shc3	A	T	13: 51,461,377	F181L	probably damaging	Het
Siglec1	A	C	2: 131,085,577	V103G	probably damaging	Het
Slc26a11	G	T	11: 119,377,259	A488S	possibly damaging	Het
Smoc2	A	T	17: 14,336,579	T97S	probably damaging	Het
Son	T	C	16: 91,655,022	I219T	possibly damaging	Het
Sptbn1	A	T	11: 30,121,510	I1474N	possibly damaging	Het
Syt16	A	T	12: 74,222,768	D127V	possibly damaging	Het
Tet1	G	T	10: 62,878,578	N479K	possibly damaging	Het
Thsd7a	G	A	6: 12,338,655	A1192V	probably benign	Het
Tmed3	G	A	9: 89,699,772	R213*	probably null	Het
Traj57	A	G	14: 54,158,559		probably benign	Het
Trpv1	G	T	11: 73,238,516	R86S	probably benign	Het
Usp48	T	A	4: 137,616,362	F434L	possibly damaging	Het
Vmn2r59	A	C	7: 42,042,410		probably null	Het
Vmn2r71	T	A	7: 85,619,222	I211N	possibly damaging	Het
Vps13b	T	A	15: 35,422,453	D186E	probably damaging	Het
Wdr12	A	T	1: 60,094,511	D19E	probably benign	Het
Zc3h12c	A	G	9: 52,126,647	F278L	probably damaging	Het
Zpld1	T	C	16: 55,246,644	T183A	probably damaging	Het
Zswim2	G	T	2: 83,939,666	T68K	possibly damaging	Het

Other mutations in Vps33a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01345:Vps33a	APN	5	123572943	missense	probably benign	0.00
IGL01459:Vps33a	APN	5	123535308	missense	probably benign	0.08
IGL02473:Vps33a	APN	5	123569571	missense	probably damaging	1.00
IGL02899:Vps33a	APN	5	123531176	missense	probably damaging	1.00
R0498:Vps33a	UTSW	5	123570961	missense	probably benign	0.40
R1134:Vps33a	UTSW	5	123570912	missense	probably damaging	0.97
R1928:Vps33a	UTSW	5	123558621	missense	probably benign	0.02
R2012:Vps33a	UTSW	5	123531181	splice site	probably null
R2926:Vps33a	UTSW	5	123569571	missense	possibly damaging	0.83
R3688:Vps33a	UTSW	5	123535211	splice site	probably null
R3872:Vps33a	UTSW	5	123531192	missense	probably benign	0.16
R4437:Vps33a	UTSW	5	123531884	missense	probably benign
R5396:Vps33a	UTSW	5	123558630	missense	probably damaging	0.98
R5686:Vps33a	UTSW	5	123547001	critical splice donor site	probably null
R5714:Vps33a	UTSW	5	123569500	missense	probably benign
R5814:Vps33a	UTSW	5	123565056	missense	probably damaging	1.00
R6845:Vps33a	UTSW	5	123535272	missense	probably benign	0.02
R7183:Vps33a	UTSW	5	123535215	missense	probably null	0.83
R7359:Vps33a	UTSW	5	123558633	missense	probably benign	0.00
R7593:Vps33a	UTSW	5	123536556	missense	probably benign	0.00
R7855:Vps33a	UTSW	5	123570979	missense	possibly damaging	0.78
R7885:Vps33a	UTSW	5	123535249	missense	possibly damaging	0.70
R8025:Vps33a	UTSW	5	123558675	missense	possibly damaging	0.76
R8139:Vps33a	UTSW	5	123533952	missense	probably benign	0.04
R8275:Vps33a	UTSW	5	123569459	missense	probably damaging	0.99
R8434:Vps33a	UTSW	5	123533881	missense	possibly damaging	0.74
R8845:Vps33a	UTSW	5	123571475	critical splice donor site	probably null
R8879:Vps33a	UTSW	5	123533899	missense	probably damaging	1.00
R8880:Vps33a	UTSW	5	123569443	missense	probably damaging	0.98
R9172:Vps33a	UTSW	5	123536541	missense	probably benign	0.17
R9440:Vps33a	UTSW	5	123564984	missense	probably damaging	1.00
R9502:Vps33a	UTSW	5	123558642	missense	probably benign	0.00
R9725:Vps33a	UTSW	5	123531072	missense	possibly damaging	0.95
X0026:Vps33a	UTSW	5	123547097	missense	possibly damaging	0.81

Predicted Primers

PCR Primer
(F):5'- CAGTTTGAGGACCTTTAATTTCCAAGG -3'
(R):5'- TCCAGAGAAGTTTGCACCC -3'

Sequencing Primer
(F):5'- CTTTACAAGTCAGCATGCATGGGC -3'
(R):5'- TTTGCACCCAAGAAGCAGG -3'

Posted On

2016-06-21