Incidental Mutation 'R5153:Lig4'
ID395520
Institutional Source Beutler Lab
Gene Symbol Lig4
Ensembl Gene ENSMUSG00000049717
Gene Nameligase IV, DNA, ATP-dependent
SynonymsDNA ligase IV, 5830471N16Rik, tiny
MMRRC Submission 042735-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5153 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location9969049-9977686 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 9973003 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 259 (V259E)
Ref Sequence ENSEMBL: ENSMUSP00000130807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048216] [ENSMUST00000095476] [ENSMUST00000139793] [ENSMUST00000170033]
Predicted Effect probably benign
Transcript: ENSMUST00000048216
SMART Domains Protein: ENSMUSP00000036730
Gene: ENSMUSG00000040396

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
transmembrane domain 39 58 N/A INTRINSIC
Pfam:Abhydrolase_5 116 299 5.6e-24 PFAM
Pfam:Abhydrolase_3 117 279 1.7e-6 PFAM
Pfam:Abhydrolase_6 117 310 4.9e-15 PFAM
Pfam:Abhydrolase_1 143 245 1.8e-8 PFAM
Pfam:AXE1 163 229 3.7e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000095476
AA Change: V259E

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000093130
Gene: ENSMUSG00000049717
AA Change: V259E

DomainStartEndE-ValueType
Pfam:DNA_ligase_A_N 14 209 1.3e-43 PFAM
Pfam:DNA_ligase_A_M 248 451 2e-50 PFAM
Pfam:DNA_ligase_A_C 476 588 3.3e-16 PFAM
BRCT 656 733 2.8e-14 SMART
Pfam:DNA_ligase_IV 749 784 7.3e-21 PFAM
BRCT 816 901 1.6e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139793
SMART Domains Protein: ENSMUSP00000116130
Gene: ENSMUSG00000040396

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
transmembrane domain 39 58 N/A INTRINSIC
Pfam:Hydrolase_4 111 250 2.5e-11 PFAM
Pfam:Abhydrolase_1 115 237 3.2e-11 PFAM
Pfam:Abhydrolase_5 116 299 6.3e-24 PFAM
Pfam:Abhydrolase_6 117 241 2.9e-8 PFAM
Pfam:AXE1 162 229 9.1e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000170033
AA Change: V259E

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000130807
Gene: ENSMUSG00000049717
AA Change: V259E

DomainStartEndE-ValueType
Pfam:DNA_ligase_A_N 15 208 8.8e-39 PFAM
Pfam:DNA_ligase_A_M 248 451 2.3e-52 PFAM
Pfam:DNA_ligase_A_C 476 588 4.8e-18 PFAM
BRCT 656 733 2.9e-14 SMART
Pfam:DNA_ligase_IV 750 783 5.5e-17 PFAM
BRCT 816 901 1.6e-5 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a DNA ligase that joins single-strand breaks in a double-stranded polydeoxynucleotide in an ATP-dependent reaction. This protein is essential for V(D)J recombination and DNA double-strand break (DSB) repair through nonhomologous end joining (NHEJ). This protein forms a complex with the X-ray repair cross complementing protein 4 (XRCC4), and further interacts with the DNA-dependent protein kinase (DNA-PK). Both XRCC4 and DNA-PK are known to be required for NHEJ. The crystal structure of the complex formed by this protein and XRCC4 has been resolved. Defects in this gene are the cause of LIG4 syndrome. Alternatively spliced transcript variants encoding the same protein have been observed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Null homozygotes die late in gestation with extensive CNS apoptosis, blocked lymphopoeiesis and failure of V(D)J joining. Carrier fibroblasts show elevated chromosome breaks. ~40% of homozygous hypomorphs survive, with retarded growth, reduced PBL and progressive loss of hematopoietic stem cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik A T 11: 99,837,247 C257S unknown Het
4930596D02Rik C A 14: 35,810,255 R121L probably benign Het
5330417C22Rik A T 3: 108,472,747 Y349N possibly damaging Het
8030411F24Rik A G 2: 148,783,440 Q98R probably benign Het
9430007A20Rik T A 4: 144,522,267 M68K probably benign Het
Acin1 A G 14: 54,645,613 V194A probably benign Het
Acsm1 T C 7: 119,640,727 I298T possibly damaging Het
Aoc1 A G 6: 48,908,747 N729D probably benign Het
Apobr C T 7: 126,587,732 T20I possibly damaging Het
Arsb A G 13: 93,940,598 E491G probably benign Het
AW209491 C G 13: 14,637,179 Q206E probably benign Het
Camsap1 A T 2: 25,933,618 N1473K probably damaging Het
Casp8 A G 1: 58,844,845 Q457R probably benign Het
Ccdc154 G A 17: 25,168,341 A350T probably damaging Het
Cecr2 A G 6: 120,734,560 E183G probably benign Het
Cep295 A T 9: 15,357,629 S39T probably benign Het
Cep350 A T 1: 155,935,946 I416K probably damaging Het
Cidea C T 18: 67,367,420 T184M probably damaging Het
Cnot10 G A 9: 114,613,735 A468V probably damaging Het
Defb22 A T 2: 152,485,802 N154K unknown Het
Dnah17 A T 11: 118,082,974 C1915* probably null Het
Dnah2 T C 11: 69,520,933 T288A possibly damaging Het
Dopey2 T A 16: 93,774,003 M1512K probably damaging Het
Dsp T G 13: 38,182,306 I572S probably damaging Het
Eepd1 A G 9: 25,586,753 H378R probably benign Het
Emilin2 A G 17: 71,273,502 M743T possibly damaging Het
Ext1 C A 15: 53,075,817 W612L probably damaging Het
F2rl2 A G 13: 95,697,112 T17A probably benign Het
Fbxl8 T G 8: 105,267,107 C32G probably damaging Het
Fbxw17 A G 13: 50,419,861 T38A probably damaging Het
Flii A T 11: 60,716,686 L882Q possibly damaging Het
Focad T G 4: 88,359,884 S1197A unknown Het
Gm6970 A G 19: 47,170,917 V73A probably damaging Het
Heatr5b G A 17: 78,795,107 R1281* probably null Het
Khdc3 A G 9: 73,103,438 Q190R probably benign Het
Krt9 T A 11: 100,191,242 D244V probably damaging Het
Ldhd T C 8: 111,627,092 E463G probably benign Het
Luc7l3 A T 11: 94,295,980 probably benign Het
Man1a2 T C 3: 100,656,263 E22G probably damaging Het
Mmp23 T G 4: 155,651,340 D258A probably damaging Het
Msantd2 C T 9: 37,523,213 R250* probably null Het
Mynn T C 3: 30,611,589 S457P probably benign Het
Nectin1 C T 9: 43,803,498 H50Y probably damaging Het
Olfr1256 G A 2: 89,835,234 T237I possibly damaging Het
Olfr516 T C 7: 108,845,699 I104V probably benign Het
Olfr709-ps1 C T 7: 106,926,569 V297M possibly damaging Het
Olfr804 A G 10: 129,705,157 N93S probably benign Het
Pfkfb2 G A 1: 130,701,790 T303M probably damaging Het
Pkhd1l1 A G 15: 44,505,309 D841G probably benign Het
Plxna4 A T 6: 32,224,159 probably null Het
Podnl1 C T 8: 84,130,643 H294Y probably benign Het
Ppig T A 2: 69,749,650 D509E unknown Het
Ppp1r16a T A 15: 76,694,396 Y433* probably null Het
Prdm1 A C 10: 44,450,225 V134G possibly damaging Het
Prx T C 7: 27,518,476 S940P probably damaging Het
Ptprd C T 4: 76,012,102 V731I probably damaging Het
Qk A G 17: 10,238,891 probably null Het
Rassf6 T C 5: 90,606,840 K206R possibly damaging Het
Rdh16f2 G A 10: 127,876,255 E194K possibly damaging Het
Rims1 C A 1: 22,483,247 G457* probably null Het
Ripk1 T G 13: 34,013,296 I123R probably damaging Het
Rnf111 A T 9: 70,476,140 S170R probably benign Het
Shc3 A T 13: 51,461,377 F181L probably damaging Het
Siglec1 A C 2: 131,085,577 V103G probably damaging Het
Slc26a11 G T 11: 119,377,259 A488S possibly damaging Het
Smoc2 A T 17: 14,336,579 T97S probably damaging Het
Son T C 16: 91,655,022 I219T possibly damaging Het
Sptbn1 A T 11: 30,121,510 I1474N possibly damaging Het
Syt16 A T 12: 74,222,768 D127V possibly damaging Het
Tet1 G T 10: 62,878,578 N479K possibly damaging Het
Thsd7a G A 6: 12,338,655 A1192V probably benign Het
Tmed3 G A 9: 89,699,772 R213* probably null Het
Traj57 A G 14: 54,158,559 probably benign Het
Trpv1 G T 11: 73,238,516 R86S probably benign Het
Usp48 T A 4: 137,616,362 F434L possibly damaging Het
Vmn2r59 A C 7: 42,042,410 probably null Het
Vmn2r71 T A 7: 85,619,222 I211N possibly damaging Het
Vps13b T A 15: 35,422,453 D186E probably damaging Het
Vps33a A G 5: 123,558,628 S321P probably damaging Het
Wdr12 A T 1: 60,094,511 D19E probably benign Het
Zc3h12c A G 9: 52,126,647 F278L probably damaging Het
Zpld1 T C 16: 55,246,644 T183A probably damaging Het
Zswim2 G T 2: 83,939,666 T68K possibly damaging Het
Other mutations in Lig4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Lig4 APN 8 9972775 missense probably damaging 1.00
IGL00655:Lig4 APN 8 9973305 missense probably benign 0.09
IGL01388:Lig4 APN 8 9973586 missense probably damaging 1.00
IGL01669:Lig4 APN 8 9973673 missense probably benign 0.01
IGL01757:Lig4 APN 8 9971185 missense probably benign 0.10
IGL02115:Lig4 APN 8 9973247 missense possibly damaging 0.58
IGL02167:Lig4 APN 8 9971821 missense probably benign 0.06
IGL02239:Lig4 APN 8 9972473 missense probably damaging 1.00
IGL02576:Lig4 APN 8 9971116 missense probably damaging 1.00
IGL02955:Lig4 APN 8 9972103 missense possibly damaging 0.95
IGL03056:Lig4 APN 8 9972580 missense possibly damaging 0.90
nosegay UTSW 8 9972954 missense probably damaging 1.00
posey UTSW 8 9972955 missense probably damaging 1.00
posey2 UTSW 8 9971585 missense probably benign
BB004:Lig4 UTSW 8 9973629 missense possibly damaging 0.92
BB014:Lig4 UTSW 8 9973629 missense possibly damaging 0.92
R0791:Lig4 UTSW 8 9973012 missense possibly damaging 0.70
R1208:Lig4 UTSW 8 9971062 missense probably damaging 1.00
R1208:Lig4 UTSW 8 9971062 missense probably damaging 1.00
R1368:Lig4 UTSW 8 9971176 missense possibly damaging 0.89
R1522:Lig4 UTSW 8 9973012 missense possibly damaging 0.70
R1566:Lig4 UTSW 8 9973650 missense probably benign 0.41
R1674:Lig4 UTSW 8 9971692 missense probably benign 0.01
R2024:Lig4 UTSW 8 9972436 missense probably damaging 1.00
R2025:Lig4 UTSW 8 9972436 missense probably damaging 1.00
R2026:Lig4 UTSW 8 9972436 missense probably damaging 1.00
R2155:Lig4 UTSW 8 9972766 missense probably benign 0.00
R2243:Lig4 UTSW 8 9972161 missense possibly damaging 0.81
R2917:Lig4 UTSW 8 9971596 missense possibly damaging 0.56
R4763:Lig4 UTSW 8 9972955 missense probably damaging 1.00
R4819:Lig4 UTSW 8 9971885 missense probably benign
R5397:Lig4 UTSW 8 9972644 missense probably benign 0.01
R5618:Lig4 UTSW 8 9972021 missense probably benign
R6102:Lig4 UTSW 8 9972872 missense probably damaging 1.00
R6210:Lig4 UTSW 8 9971585 missense probably benign
R6312:Lig4 UTSW 8 9971739 missense probably benign
R6955:Lig4 UTSW 8 9973384 missense probably damaging 1.00
R6991:Lig4 UTSW 8 9971098 missense probably damaging 0.99
R7207:Lig4 UTSW 8 9972101 nonsense probably null
R7769:Lig4 UTSW 8 9973629 missense possibly damaging 0.92
R7927:Lig4 UTSW 8 9973629 missense possibly damaging 0.92
R8113:Lig4 UTSW 8 9973485 missense probably benign 0.07
R8124:Lig4 UTSW 8 9972954 missense probably damaging 1.00
R8382:Lig4 UTSW 8 9972346 missense probably damaging 1.00
R8443:Lig4 UTSW 8 9973777 start codon destroyed probably null 0.00
Predicted Primers PCR Primer
(F):5'- TTGCACATCTGTCCCGAACG -3'
(R):5'- TCAAAGACTTAAAGCTTGGCATCAG -3'

Sequencing Primer
(F):5'- TGTCCCGAACGCATTGTG -3'
(R):5'- GACTTAAAGCTTGGCATCAGTCAGC -3'
Posted On2016-06-21