Incidental Mutation 'R5153:Cep295'
ID395524
Institutional Source Beutler Lab
Gene Symbol Cep295
Ensembl Gene ENSMUSG00000046111
Gene Namecentrosomal protein 295
SynonymsLOC382128, 5830418K08Rik
MMRRC Submission 042735-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.949) question?
Stock #R5153 (G1)
Quality Score116
Status Not validated
Chromosome9
Chromosomal Location15316915-15357788 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 15357629 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 39 (S39T)
Ref Sequence ENSEMBL: ENSMUSP00000096578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098979] [ENSMUST00000161132]
Predicted Effect probably benign
Transcript: ENSMUST00000098979
AA Change: S39T

PolyPhen 2 Score 0.321 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000096578
Gene: ENSMUSG00000046111
AA Change: S39T

DomainStartEndE-ValueType
low complexity region 159 175 N/A INTRINSIC
coiled coil region 258 288 N/A INTRINSIC
coiled coil region 536 583 N/A INTRINSIC
coiled coil region 861 889 N/A INTRINSIC
internal_repeat_1 890 1104 6.8e-5 PROSPERO
internal_repeat_1 1277 1489 6.8e-5 PROSPERO
low complexity region 1537 1548 N/A INTRINSIC
low complexity region 1611 1625 N/A INTRINSIC
coiled coil region 1707 1736 N/A INTRINSIC
low complexity region 2003 2018 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161132
AA Change: S39T

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000123788
Gene: ENSMUSG00000046111
AA Change: S39T

DomainStartEndE-ValueType
low complexity region 111 127 N/A INTRINSIC
coiled coil region 210 240 N/A INTRINSIC
coiled coil region 488 535 N/A INTRINSIC
coiled coil region 813 841 N/A INTRINSIC
coiled coil region 1300 1327 N/A INTRINSIC
low complexity region 1489 1500 N/A INTRINSIC
low complexity region 1563 1577 N/A INTRINSIC
coiled coil region 1659 1688 N/A INTRINSIC
low complexity region 2035 2050 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik A T 11: 99,837,247 C257S unknown Het
4930596D02Rik C A 14: 35,810,255 R121L probably benign Het
5330417C22Rik A T 3: 108,472,747 Y349N possibly damaging Het
8030411F24Rik A G 2: 148,783,440 Q98R probably benign Het
9430007A20Rik T A 4: 144,522,267 M68K probably benign Het
Acin1 A G 14: 54,645,613 V194A probably benign Het
Acsm1 T C 7: 119,640,727 I298T possibly damaging Het
Aoc1 A G 6: 48,908,747 N729D probably benign Het
Apobr C T 7: 126,587,732 T20I possibly damaging Het
Arsb A G 13: 93,940,598 E491G probably benign Het
AW209491 C G 13: 14,637,179 Q206E probably benign Het
Camsap1 A T 2: 25,933,618 N1473K probably damaging Het
Casp8 A G 1: 58,844,845 Q457R probably benign Het
Ccdc154 G A 17: 25,168,341 A350T probably damaging Het
Cecr2 A G 6: 120,734,560 E183G probably benign Het
Cep350 A T 1: 155,935,946 I416K probably damaging Het
Cidea C T 18: 67,367,420 T184M probably damaging Het
Cnot10 G A 9: 114,613,735 A468V probably damaging Het
Defb22 A T 2: 152,485,802 N154K unknown Het
Dnah17 A T 11: 118,082,974 C1915* probably null Het
Dnah2 T C 11: 69,520,933 T288A possibly damaging Het
Dopey2 T A 16: 93,774,003 M1512K probably damaging Het
Dsp T G 13: 38,182,306 I572S probably damaging Het
Eepd1 A G 9: 25,586,753 H378R probably benign Het
Emilin2 A G 17: 71,273,502 M743T possibly damaging Het
Ext1 C A 15: 53,075,817 W612L probably damaging Het
F2rl2 A G 13: 95,697,112 T17A probably benign Het
Fbxl8 T G 8: 105,267,107 C32G probably damaging Het
Fbxw17 A G 13: 50,419,861 T38A probably damaging Het
Flii A T 11: 60,716,686 L882Q possibly damaging Het
Focad T G 4: 88,359,884 S1197A unknown Het
Gm6970 A G 19: 47,170,917 V73A probably damaging Het
Heatr5b G A 17: 78,795,107 R1281* probably null Het
Khdc3 A G 9: 73,103,438 Q190R probably benign Het
Krt9 T A 11: 100,191,242 D244V probably damaging Het
Ldhd T C 8: 111,627,092 E463G probably benign Het
Lig4 A T 8: 9,973,003 V259E possibly damaging Het
Luc7l3 A T 11: 94,295,980 probably benign Het
Man1a2 T C 3: 100,656,263 E22G probably damaging Het
Mmp23 T G 4: 155,651,340 D258A probably damaging Het
Msantd2 C T 9: 37,523,213 R250* probably null Het
Mynn T C 3: 30,611,589 S457P probably benign Het
Nectin1 C T 9: 43,803,498 H50Y probably damaging Het
Olfr1256 G A 2: 89,835,234 T237I possibly damaging Het
Olfr516 T C 7: 108,845,699 I104V probably benign Het
Olfr709-ps1 C T 7: 106,926,569 V297M possibly damaging Het
Olfr804 A G 10: 129,705,157 N93S probably benign Het
Pfkfb2 G A 1: 130,701,790 T303M probably damaging Het
Pkhd1l1 A G 15: 44,505,309 D841G probably benign Het
Plxna4 A T 6: 32,224,159 probably null Het
Podnl1 C T 8: 84,130,643 H294Y probably benign Het
Ppig T A 2: 69,749,650 D509E unknown Het
Ppp1r16a T A 15: 76,694,396 Y433* probably null Het
Prdm1 A C 10: 44,450,225 V134G possibly damaging Het
Prx T C 7: 27,518,476 S940P probably damaging Het
Ptprd C T 4: 76,012,102 V731I probably damaging Het
Qk A G 17: 10,238,891 probably null Het
Rassf6 T C 5: 90,606,840 K206R possibly damaging Het
Rdh16f2 G A 10: 127,876,255 E194K possibly damaging Het
Rims1 C A 1: 22,483,247 G457* probably null Het
Ripk1 T G 13: 34,013,296 I123R probably damaging Het
Rnf111 A T 9: 70,476,140 S170R probably benign Het
Shc3 A T 13: 51,461,377 F181L probably damaging Het
Siglec1 A C 2: 131,085,577 V103G probably damaging Het
Slc26a11 G T 11: 119,377,259 A488S possibly damaging Het
Smoc2 A T 17: 14,336,579 T97S probably damaging Het
Son T C 16: 91,655,022 I219T possibly damaging Het
Sptbn1 A T 11: 30,121,510 I1474N possibly damaging Het
Syt16 A T 12: 74,222,768 D127V possibly damaging Het
Tet1 G T 10: 62,878,578 N479K possibly damaging Het
Thsd7a G A 6: 12,338,655 A1192V probably benign Het
Tmed3 G A 9: 89,699,772 R213* probably null Het
Traj57 A G 14: 54,158,559 probably benign Het
Trpv1 G T 11: 73,238,516 R86S probably benign Het
Usp48 T A 4: 137,616,362 F434L possibly damaging Het
Vmn2r59 A C 7: 42,042,410 probably null Het
Vmn2r71 T A 7: 85,619,222 I211N possibly damaging Het
Vps13b T A 15: 35,422,453 D186E probably damaging Het
Vps33a A G 5: 123,558,628 S321P probably damaging Het
Wdr12 A T 1: 60,094,511 D19E probably benign Het
Zc3h12c A G 9: 52,126,647 F278L probably damaging Het
Zpld1 T C 16: 55,246,644 T183A probably damaging Het
Zswim2 G T 2: 83,939,666 T68K possibly damaging Het
Other mutations in Cep295
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Cep295 APN 9 15326072 splice site probably null
IGL00769:Cep295 APN 9 15326144 missense probably damaging 1.00
IGL00771:Cep295 APN 9 15322565 missense probably damaging 1.00
IGL00850:Cep295 APN 9 15322852 missense probably benign 0.36
IGL01505:Cep295 APN 9 15318049 missense probably benign 0.08
IGL01510:Cep295 APN 9 15354626 nonsense probably null
IGL01759:Cep295 APN 9 15323559 unclassified probably null
IGL02415:Cep295 APN 9 15353020 missense probably damaging 1.00
IGL02447:Cep295 APN 9 15332511 missense probably damaging 0.98
IGL02502:Cep295 APN 9 15350913 splice site probably benign
IGL02665:Cep295 APN 9 15326632 splice site probably benign
IGL02718:Cep295 APN 9 15325753 splice site probably null
IGL02995:Cep295 APN 9 15333312 missense probably damaging 1.00
IGL03024:Cep295 APN 9 15325572 missense probably benign
R0196:Cep295 UTSW 9 15338213 missense probably damaging 0.96
R0398:Cep295 UTSW 9 15354736 missense possibly damaging 0.90
R0595:Cep295 UTSW 9 15332191 nonsense probably null
R0610:Cep295 UTSW 9 15322754 missense possibly damaging 0.81
R0616:Cep295 UTSW 9 15332322 nonsense probably null
R0840:Cep295 UTSW 9 15334315 missense probably benign 0.02
R1215:Cep295 UTSW 9 15327882 missense probably benign 0.00
R1376:Cep295 UTSW 9 15340868 splice site probably benign
R1381:Cep295 UTSW 9 15322565 missense probably benign 0.02
R1484:Cep295 UTSW 9 15334784 missense probably damaging 0.99
R1557:Cep295 UTSW 9 15332010 nonsense probably null
R1655:Cep295 UTSW 9 15340883 missense probably damaging 0.99
R1682:Cep295 UTSW 9 15333921 missense probably benign 0.02
R1700:Cep295 UTSW 9 15340883 missense probably damaging 0.99
R1734:Cep295 UTSW 9 15340883 missense probably damaging 0.99
R1736:Cep295 UTSW 9 15340883 missense probably damaging 0.99
R1743:Cep295 UTSW 9 15340883 missense probably damaging 0.99
R1765:Cep295 UTSW 9 15327904 missense probably damaging 1.00
R1889:Cep295 UTSW 9 15332103 missense possibly damaging 0.94
R1895:Cep295 UTSW 9 15332103 missense possibly damaging 0.94
R1994:Cep295 UTSW 9 15340883 missense probably damaging 0.99
R1995:Cep295 UTSW 9 15340883 missense probably damaging 0.99
R2071:Cep295 UTSW 9 15341564 missense probably damaging 1.00
R2161:Cep295 UTSW 9 15353058 missense probably damaging 0.99
R2195:Cep295 UTSW 9 15332321 missense probably damaging 0.99
R2354:Cep295 UTSW 9 15334784 missense possibly damaging 0.92
R2427:Cep295 UTSW 9 15334238 missense probably damaging 1.00
R2992:Cep295 UTSW 9 15332747 missense probably damaging 1.00
R3873:Cep295 UTSW 9 15333365 missense probably damaging 1.00
R3981:Cep295 UTSW 9 15317067 utr 3 prime probably benign
R4201:Cep295 UTSW 9 15332538 missense probably benign 0.19
R4297:Cep295 UTSW 9 15322654 missense probably benign 0.19
R4543:Cep295 UTSW 9 15335253 missense possibly damaging 0.94
R4584:Cep295 UTSW 9 15334799 missense possibly damaging 0.96
R4724:Cep295 UTSW 9 15330832 missense probably damaging 1.00
R4878:Cep295 UTSW 9 15334956 missense probably benign 0.11
R4884:Cep295 UTSW 9 15351760 missense probably damaging 1.00
R4934:Cep295 UTSW 9 15333160 missense probably damaging 0.97
R4990:Cep295 UTSW 9 15332138 missense probably damaging 1.00
R5057:Cep295 UTSW 9 15322683 missense probably benign 0.00
R5180:Cep295 UTSW 9 15332120 missense probably benign
R5285:Cep295 UTSW 9 15322591 missense probably benign 0.14
R5360:Cep295 UTSW 9 15326733 missense probably damaging 1.00
R5419:Cep295 UTSW 9 15324237 missense probably damaging 0.98
R5432:Cep295 UTSW 9 15351695 missense possibly damaging 0.95
R5625:Cep295 UTSW 9 15340891 missense probably damaging 0.99
R5637:Cep295 UTSW 9 15333812 unclassified probably null
R5645:Cep295 UTSW 9 15332794 missense probably damaging 0.98
R5645:Cep295 UTSW 9 15335108 missense possibly damaging 0.89
R5678:Cep295 UTSW 9 15322858 missense probably damaging 0.99
R5688:Cep295 UTSW 9 15331986 missense probably damaging 1.00
R5807:Cep295 UTSW 9 15332532 missense probably damaging 1.00
R5824:Cep295 UTSW 9 15325656 missense possibly damaging 0.90
R5837:Cep295 UTSW 9 15346984 missense probably damaging 0.99
R5915:Cep295 UTSW 9 15341479 missense probably damaging 1.00
R5988:Cep295 UTSW 9 15341474 missense probably damaging 1.00
R6239:Cep295 UTSW 9 15322631 missense possibly damaging 0.46
R6332:Cep295 UTSW 9 15334914 missense possibly damaging 0.90
R6383:Cep295 UTSW 9 15332754 missense probably damaging 0.99
R6737:Cep295 UTSW 9 15332351 missense possibly damaging 0.90
R6929:Cep295 UTSW 9 15333062 missense probably damaging 1.00
R7428:Cep295 UTSW 9 15333498 missense possibly damaging 0.61
X0065:Cep295 UTSW 9 15322891 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- TTCATAGCTTGAGTGTAGGAAGAG -3'
(R):5'- GACAAGACCCTGACAGTTGAG -3'

Sequencing Primer
(F):5'- CTTGAGTGTAGGAAGAGTACCAG -3'
(R):5'- ATAATGGCCCGTTGCGCAAG -3'
Posted On2016-06-21