Incidental Mutation 'R5153:Vps13b'
ID 395560
Institutional Source Beutler Lab
Gene Symbol Vps13b
Ensembl Gene ENSMUSG00000037646
Gene Name vacuolar protein sorting 13B
Synonyms 2310042E16Rik, 1810042B05Rik, Coh1, C330002D13Rik
MMRRC Submission 042735-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5153 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 35371160-35931229 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 35422453 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 186 (D186E)
Ref Sequence ENSEMBL: ENSMUSP00000045490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048646]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000048646
AA Change: D186E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000045490
Gene: ENSMUSG00000037646
AA Change: D186E

DomainStartEndE-ValueType
Pfam:Chorein_N 2 120 1e-29 PFAM
low complexity region 128 137 N/A INTRINSIC
low complexity region 143 160 N/A INTRINSIC
low complexity region 975 984 N/A INTRINSIC
low complexity region 1007 1018 N/A INTRINSIC
low complexity region 1876 1883 N/A INTRINSIC
low complexity region 2042 2054 N/A INTRINSIC
low complexity region 2414 2423 N/A INTRINSIC
Pfam:SHR-BD 2601 2700 8.4e-10 PFAM
low complexity region 2954 2964 N/A INTRINSIC
Pfam:VPS13_C 3539 3706 2.6e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226579
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227309
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228338
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a potential transmembrane protein that may function in vesicle-mediated transport and sorting of proteins within the cell. This protein may play a role in the development and the function of the eye, hematological system, and central nervous system. Mutations in this gene have been associated with Cohen syndrome. Multiple splice variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik A T 11: 99,837,247 C257S unknown Het
4930596D02Rik C A 14: 35,810,255 R121L probably benign Het
5330417C22Rik A T 3: 108,472,747 Y349N possibly damaging Het
8030411F24Rik A G 2: 148,783,440 Q98R probably benign Het
9430007A20Rik T A 4: 144,522,267 M68K probably benign Het
Acin1 A G 14: 54,645,613 V194A probably benign Het
Acsm1 T C 7: 119,640,727 I298T possibly damaging Het
Aoc1 A G 6: 48,908,747 N729D probably benign Het
Apobr C T 7: 126,587,732 T20I possibly damaging Het
Arsb A G 13: 93,940,598 E491G probably benign Het
AW209491 C G 13: 14,637,179 Q206E probably benign Het
Camsap1 A T 2: 25,933,618 N1473K probably damaging Het
Casp8 A G 1: 58,844,845 Q457R probably benign Het
Ccdc154 G A 17: 25,168,341 A350T probably damaging Het
Cecr2 A G 6: 120,734,560 E183G probably benign Het
Cep295 A T 9: 15,357,629 S39T probably benign Het
Cep350 A T 1: 155,935,946 I416K probably damaging Het
Cidea C T 18: 67,367,420 T184M probably damaging Het
Cnot10 G A 9: 114,613,735 A468V probably damaging Het
Defb22 A T 2: 152,485,802 N154K unknown Het
Dnah17 A T 11: 118,082,974 C1915* probably null Het
Dnah2 T C 11: 69,520,933 T288A possibly damaging Het
Dopey2 T A 16: 93,774,003 M1512K probably damaging Het
Dsp T G 13: 38,182,306 I572S probably damaging Het
Eepd1 A G 9: 25,586,753 H378R probably benign Het
Emilin2 A G 17: 71,273,502 M743T possibly damaging Het
Ext1 C A 15: 53,075,817 W612L probably damaging Het
F2rl2 A G 13: 95,697,112 T17A probably benign Het
Fbxl8 T G 8: 105,267,107 C32G probably damaging Het
Fbxw17 A G 13: 50,419,861 T38A probably damaging Het
Flii A T 11: 60,716,686 L882Q possibly damaging Het
Focad T G 4: 88,359,884 S1197A unknown Het
Gm6970 A G 19: 47,170,917 V73A probably damaging Het
Heatr5b G A 17: 78,795,107 R1281* probably null Het
Khdc3 A G 9: 73,103,438 Q190R probably benign Het
Krt9 T A 11: 100,191,242 D244V probably damaging Het
Ldhd T C 8: 111,627,092 E463G probably benign Het
Lig4 A T 8: 9,973,003 V259E possibly damaging Het
Luc7l3 A T 11: 94,295,980 probably benign Het
Man1a2 T C 3: 100,656,263 E22G probably damaging Het
Mmp23 T G 4: 155,651,340 D258A probably damaging Het
Msantd2 C T 9: 37,523,213 R250* probably null Het
Mynn T C 3: 30,611,589 S457P probably benign Het
Nectin1 C T 9: 43,803,498 H50Y probably damaging Het
Olfr1256 G A 2: 89,835,234 T237I possibly damaging Het
Olfr516 T C 7: 108,845,699 I104V probably benign Het
Olfr709-ps1 C T 7: 106,926,569 V297M possibly damaging Het
Olfr804 A G 10: 129,705,157 N93S probably benign Het
Pfkfb2 G A 1: 130,701,790 T303M probably damaging Het
Pkhd1l1 A G 15: 44,505,309 D841G probably benign Het
Plxna4 A T 6: 32,224,159 probably null Het
Podnl1 C T 8: 84,130,643 H294Y probably benign Het
Ppig T A 2: 69,749,650 D509E unknown Het
Ppp1r16a T A 15: 76,694,396 Y433* probably null Het
Prdm1 A C 10: 44,450,225 V134G possibly damaging Het
Prx T C 7: 27,518,476 S940P probably damaging Het
Ptprd C T 4: 76,012,102 V731I probably damaging Het
Qk A G 17: 10,238,891 probably null Het
Rassf6 T C 5: 90,606,840 K206R possibly damaging Het
Rdh16f2 G A 10: 127,876,255 E194K possibly damaging Het
Rims1 C A 1: 22,483,247 G457* probably null Het
Ripk1 T G 13: 34,013,296 I123R probably damaging Het
Rnf111 A T 9: 70,476,140 S170R probably benign Het
Shc3 A T 13: 51,461,377 F181L probably damaging Het
Siglec1 A C 2: 131,085,577 V103G probably damaging Het
Slc26a11 G T 11: 119,377,259 A488S possibly damaging Het
Smoc2 A T 17: 14,336,579 T97S probably damaging Het
Son T C 16: 91,655,022 I219T possibly damaging Het
Sptbn1 A T 11: 30,121,510 I1474N possibly damaging Het
Syt16 A T 12: 74,222,768 D127V possibly damaging Het
Tet1 G T 10: 62,878,578 N479K possibly damaging Het
Thsd7a G A 6: 12,338,655 A1192V probably benign Het
Tmed3 G A 9: 89,699,772 R213* probably null Het
Traj57 A G 14: 54,158,559 probably benign Het
Trpv1 G T 11: 73,238,516 R86S probably benign Het
Usp48 T A 4: 137,616,362 F434L possibly damaging Het
Vmn2r59 A C 7: 42,042,410 probably null Het
Vmn2r71 T A 7: 85,619,222 I211N possibly damaging Het
Vps33a A G 5: 123,558,628 S321P probably damaging Het
Wdr12 A T 1: 60,094,511 D19E probably benign Het
Zc3h12c A G 9: 52,126,647 F278L probably damaging Het
Zpld1 T C 16: 55,246,644 T183A probably damaging Het
Zswim2 G T 2: 83,939,666 T68K possibly damaging Het
Other mutations in Vps13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Vps13b APN 15 35926226 missense possibly damaging 0.52
IGL00513:Vps13b APN 15 35793884 missense probably damaging 1.00
IGL00516:Vps13b APN 15 35640557 missense probably damaging 1.00
IGL00640:Vps13b APN 15 35417577 missense probably benign
IGL00753:Vps13b APN 15 35372031 missense probably damaging 0.99
IGL00784:Vps13b APN 15 35846900 missense probably damaging 1.00
IGL01138:Vps13b APN 15 35446770 splice site probably benign
IGL01349:Vps13b APN 15 35793945 missense probably benign 0.00
IGL01403:Vps13b APN 15 35709479 missense probably benign 0.00
IGL01535:Vps13b APN 15 35454957 missense possibly damaging 0.67
IGL01571:Vps13b APN 15 35877489 splice site probably benign
IGL01642:Vps13b APN 15 35792072 missense probably benign 0.43
IGL01658:Vps13b APN 15 35671333 missense probably damaging 0.99
IGL01759:Vps13b APN 15 35878789 missense probably damaging 1.00
IGL01763:Vps13b APN 15 35709799 missense possibly damaging 0.72
IGL01906:Vps13b APN 15 35639847 splice site probably benign
IGL01982:Vps13b APN 15 35438904 nonsense probably null
IGL01997:Vps13b APN 15 35709224 missense probably damaging 1.00
IGL02041:Vps13b APN 15 35423245 missense probably damaging 0.98
IGL02073:Vps13b APN 15 35875586 missense possibly damaging 0.52
IGL02077:Vps13b APN 15 35910613 missense possibly damaging 0.68
IGL02141:Vps13b APN 15 35572081 missense probably benign 0.09
IGL02146:Vps13b APN 15 35646333 missense probably benign 0.36
IGL02197:Vps13b APN 15 35930056 missense probably benign 0.02
IGL02311:Vps13b APN 15 35709514 missense probably benign 0.08
IGL02466:Vps13b APN 15 35770741 missense possibly damaging 0.86
IGL02506:Vps13b APN 15 35917162 missense probably damaging 1.00
IGL02550:Vps13b APN 15 35572096 missense probably benign
IGL02553:Vps13b APN 15 35646301 missense probably benign 0.00
IGL02674:Vps13b APN 15 35639958 missense probably benign 0.41
IGL02690:Vps13b APN 15 35917142 missense probably damaging 1.00
IGL02731:Vps13b APN 15 35917128 missense probably benign 0.00
IGL02739:Vps13b APN 15 35879900 missense probably damaging 1.00
IGL02868:Vps13b APN 15 35884519 missense probably benign 0.03
IGL03081:Vps13b APN 15 35875820 missense probably damaging 0.97
IGL03178:Vps13b APN 15 35869300 missense probably damaging 1.00
IGL03343:Vps13b APN 15 35917170 missense possibly damaging 0.76
IGL03407:Vps13b APN 15 35639866 missense possibly damaging 0.95
IGL03410:Vps13b APN 15 35910340 missense probably benign
omlette UTSW 15 35671400 missense probably benign 0.13
swiss UTSW 15 35709673 missense possibly damaging 0.80
FR4449:Vps13b UTSW 15 35846957 missense probably damaging 1.00
FR4548:Vps13b UTSW 15 35846957 missense probably damaging 1.00
FR4737:Vps13b UTSW 15 35846957 missense probably damaging 1.00
FR4976:Vps13b UTSW 15 35846957 missense probably damaging 1.00
LCD18:Vps13b UTSW 15 35846957 missense probably damaging 1.00
PIT4531001:Vps13b UTSW 15 35878825 missense probably damaging 1.00
PIT4581001:Vps13b UTSW 15 35534263 missense probably damaging 1.00
PIT4618001:Vps13b UTSW 15 35709240 missense probably damaging 1.00
R0026:Vps13b UTSW 15 35923301 missense possibly damaging 0.62
R0026:Vps13b UTSW 15 35923301 missense possibly damaging 0.62
R0108:Vps13b UTSW 15 35572119 missense probably benign 0.20
R0109:Vps13b UTSW 15 35572119 missense probably benign 0.20
R0109:Vps13b UTSW 15 35572119 missense probably benign 0.20
R0116:Vps13b UTSW 15 35423155 missense probably damaging 0.99
R0123:Vps13b UTSW 15 35887261 missense probably benign 0.01
R0124:Vps13b UTSW 15 35576528 critical splice donor site probably null
R0134:Vps13b UTSW 15 35887261 missense probably benign 0.01
R0137:Vps13b UTSW 15 35926219 missense probably benign 0.06
R0195:Vps13b UTSW 15 35471899 missense probably benign 0.00
R0225:Vps13b UTSW 15 35887261 missense probably benign 0.01
R0320:Vps13b UTSW 15 35674828 missense probably damaging 0.98
R0333:Vps13b UTSW 15 35879803 missense probably damaging 1.00
R0336:Vps13b UTSW 15 35455133 nonsense probably null
R0463:Vps13b UTSW 15 35597409 missense probably damaging 0.98
R0466:Vps13b UTSW 15 35445602 nonsense probably null
R0472:Vps13b UTSW 15 35417633 critical splice donor site probably null
R0523:Vps13b UTSW 15 35472050 missense probably benign 0.20
R0602:Vps13b UTSW 15 35422368 missense probably damaging 1.00
R0612:Vps13b UTSW 15 35623657 missense probably benign 0.12
R0627:Vps13b UTSW 15 35371999 nonsense probably null
R0679:Vps13b UTSW 15 35709703 missense possibly damaging 0.73
R0742:Vps13b UTSW 15 35794361 missense probably benign 0.22
R1053:Vps13b UTSW 15 35652363 missense probably damaging 1.00
R1355:Vps13b UTSW 15 35422454 missense probably damaging 1.00
R1386:Vps13b UTSW 15 35923312 missense probably damaging 0.99
R1403:Vps13b UTSW 15 35709122 splice site probably benign
R1453:Vps13b UTSW 15 35422444 missense probably damaging 0.97
R1464:Vps13b UTSW 15 35709484 missense probably benign 0.14
R1464:Vps13b UTSW 15 35709484 missense probably benign 0.14
R1511:Vps13b UTSW 15 35839975 missense probably damaging 0.99
R1511:Vps13b UTSW 15 35841573 missense probably benign 0.00
R1513:Vps13b UTSW 15 35438730 nonsense probably null
R1536:Vps13b UTSW 15 35875566 missense probably damaging 0.98
R1537:Vps13b UTSW 15 35792181 missense possibly damaging 0.62
R1558:Vps13b UTSW 15 35534319 missense probably damaging 1.00
R1601:Vps13b UTSW 15 35642436 missense probably benign 0.11
R1653:Vps13b UTSW 15 35607272 nonsense probably null
R1695:Vps13b UTSW 15 35576521 missense probably benign 0.05
R1760:Vps13b UTSW 15 35884619 missense possibly damaging 0.54
R1785:Vps13b UTSW 15 35879791 missense probably damaging 1.00
R1786:Vps13b UTSW 15 35879791 missense probably damaging 1.00
R1803:Vps13b UTSW 15 35430205 nonsense probably null
R1804:Vps13b UTSW 15 35917137 missense probably damaging 1.00
R1808:Vps13b UTSW 15 35792059 missense probably benign 0.00
R1817:Vps13b UTSW 15 35910642 missense possibly damaging 0.86
R1818:Vps13b UTSW 15 35877577 missense probably benign 0.00
R1836:Vps13b UTSW 15 35910232 missense probably damaging 0.99
R1850:Vps13b UTSW 15 35674959 splice site probably benign
R1884:Vps13b UTSW 15 35430291 splice site probably benign
R1938:Vps13b UTSW 15 35709507 missense probably damaging 1.00
R1955:Vps13b UTSW 15 35925408 critical splice donor site probably null
R1956:Vps13b UTSW 15 35869407 missense probably damaging 1.00
R1958:Vps13b UTSW 15 35878689 missense probably damaging 0.99
R2013:Vps13b UTSW 15 35607142 missense probably damaging 0.99
R2014:Vps13b UTSW 15 35607142 missense probably damaging 0.99
R2015:Vps13b UTSW 15 35607142 missense probably damaging 0.99
R2038:Vps13b UTSW 15 35884741 missense probably damaging 1.00
R2058:Vps13b UTSW 15 35841447 missense probably damaging 1.00
R2082:Vps13b UTSW 15 35910746 missense possibly damaging 0.70
R2087:Vps13b UTSW 15 35597493 missense probably damaging 0.99
R2124:Vps13b UTSW 15 35646080 missense probably benign 0.08
R2130:Vps13b UTSW 15 35671400 missense probably benign 0.13
R2168:Vps13b UTSW 15 35792188 missense probably damaging 1.00
R2168:Vps13b UTSW 15 35792189 missense probably damaging 1.00
R2171:Vps13b UTSW 15 35887197 missense probably benign 0.44
R2221:Vps13b UTSW 15 35884597 missense probably benign
R2263:Vps13b UTSW 15 35646181 missense probably benign 0.02
R2289:Vps13b UTSW 15 35572105 missense probably damaging 1.00
R2316:Vps13b UTSW 15 35674899 nonsense probably null
R2351:Vps13b UTSW 15 35869311 missense probably damaging 1.00
R2512:Vps13b UTSW 15 35884555 missense probably benign 0.35
R3054:Vps13b UTSW 15 35646361 missense probably damaging 0.99
R3055:Vps13b UTSW 15 35646361 missense probably damaging 0.99
R3196:Vps13b UTSW 15 35869395 missense probably damaging 1.00
R3236:Vps13b UTSW 15 35910304 missense probably benign 0.40
R3404:Vps13b UTSW 15 35926054 missense probably damaging 1.00
R3722:Vps13b UTSW 15 35671382 missense probably damaging 0.99
R4077:Vps13b UTSW 15 35455128 missense probably damaging 0.99
R4153:Vps13b UTSW 15 35792027 splice site probably null
R4224:Vps13b UTSW 15 35876419 missense probably damaging 0.99
R4408:Vps13b UTSW 15 35709294 missense probably damaging 0.98
R4431:Vps13b UTSW 15 35770753 missense probably damaging 1.00
R4449:Vps13b UTSW 15 35876793 missense possibly damaging 0.86
R4508:Vps13b UTSW 15 35709673 missense possibly damaging 0.80
R4631:Vps13b UTSW 15 35646132 missense possibly damaging 0.95
R4655:Vps13b UTSW 15 35770689 missense probably benign
R4666:Vps13b UTSW 15 35640544 missense probably benign 0.13
R4684:Vps13b UTSW 15 35646178 missense probably damaging 0.98
R4684:Vps13b UTSW 15 35841341 missense probably benign
R4684:Vps13b UTSW 15 35879821 missense probably benign
R4721:Vps13b UTSW 15 35910718 nonsense probably null
R4771:Vps13b UTSW 15 35910800 missense probably damaging 1.00
R4830:Vps13b UTSW 15 35452224 missense possibly damaging 0.94
R4835:Vps13b UTSW 15 35869372 missense probably damaging 1.00
R4835:Vps13b UTSW 15 35910293 missense probably benign
R4857:Vps13b UTSW 15 35456654 missense probably benign 0.01
R4891:Vps13b UTSW 15 35640515 splice site probably null
R5095:Vps13b UTSW 15 35923202 missense probably damaging 1.00
R5110:Vps13b UTSW 15 35770809 missense probably damaging 0.99
R5147:Vps13b UTSW 15 35456678 missense probably benign 0.32
R5257:Vps13b UTSW 15 35794421 missense possibly damaging 0.75
R5258:Vps13b UTSW 15 35794421 missense possibly damaging 0.75
R5296:Vps13b UTSW 15 35876413 missense probably damaging 1.00
R5386:Vps13b UTSW 15 35640528 critical splice acceptor site probably null
R5396:Vps13b UTSW 15 35886948 missense probably damaging 0.99
R5412:Vps13b UTSW 15 35533385 missense probably damaging 1.00
R5488:Vps13b UTSW 15 35770542 missense probably benign
R5489:Vps13b UTSW 15 35770542 missense probably benign
R5503:Vps13b UTSW 15 35452166 missense probably damaging 0.97
R5575:Vps13b UTSW 15 35929919 missense probably damaging 1.00
R5781:Vps13b UTSW 15 35794035 missense probably damaging 0.97
R5872:Vps13b UTSW 15 35869351 missense possibly damaging 0.56
R5876:Vps13b UTSW 15 35917061 missense probably damaging 0.99
R5994:Vps13b UTSW 15 35875772 missense probably damaging 1.00
R6031:Vps13b UTSW 15 35471968 missense probably damaging 1.00
R6031:Vps13b UTSW 15 35471968 missense probably damaging 1.00
R6045:Vps13b UTSW 15 35671316 missense probably damaging 0.99
R6143:Vps13b UTSW 15 35668738 missense probably damaging 0.99
R6147:Vps13b UTSW 15 35930031 missense probably benign 0.16
R6218:Vps13b UTSW 15 35770464 missense probably benign 0.00
R6447:Vps13b UTSW 15 35572126 missense probably benign 0.02
R6555:Vps13b UTSW 15 35846847 missense probably damaging 1.00
R6578:Vps13b UTSW 15 35446101 missense probably damaging 0.99
R6640:Vps13b UTSW 15 35617696 missense possibly damaging 0.93
R6645:Vps13b UTSW 15 35910305 missense probably benign 0.25
R6711:Vps13b UTSW 15 35887249 missense probably damaging 1.00
R6727:Vps13b UTSW 15 35770683 missense probably benign 0.19
R6737:Vps13b UTSW 15 35910611 missense probably damaging 1.00
R6844:Vps13b UTSW 15 35877590 missense probably benign 0.06
R6849:Vps13b UTSW 15 35905309 missense probably damaging 1.00
R6861:Vps13b UTSW 15 35576395 missense probably damaging 0.99
R6938:Vps13b UTSW 15 35423198 missense probably damaging 0.99
R6943:Vps13b UTSW 15 35448689 missense possibly damaging 0.95
R6989:Vps13b UTSW 15 35448581 missense probably benign 0.02
R7092:Vps13b UTSW 15 35640634 missense probably damaging 1.00
R7232:Vps13b UTSW 15 35877557 missense probably damaging 1.00
R7307:Vps13b UTSW 15 35841545 missense probably benign
R7400:Vps13b UTSW 15 35378900 missense probably damaging 1.00
R7414:Vps13b UTSW 15 35910827 missense probably damaging 1.00
R7497:Vps13b UTSW 15 35876697 missense probably benign 0.38
R7500:Vps13b UTSW 15 35910524 missense possibly damaging 0.74
R7603:Vps13b UTSW 15 35576439 missense probably damaging 0.98
R7605:Vps13b UTSW 15 35770646 missense probably damaging 0.97
R7849:Vps13b UTSW 15 35423232 missense probably damaging 0.99
R7984:Vps13b UTSW 15 35879913 missense probably benign
R8094:Vps13b UTSW 15 35668906 critical splice donor site probably null
R8097:Vps13b UTSW 15 35709346 missense probably benign 0.38
R8131:Vps13b UTSW 15 35372109 critical splice donor site probably null
R8139:Vps13b UTSW 15 35607272 nonsense probably null
R8174:Vps13b UTSW 15 35709310 nonsense probably null
R8225:Vps13b UTSW 15 35794382 missense probably damaging 0.99
R8239:Vps13b UTSW 15 35597404 missense probably damaging 1.00
R8244:Vps13b UTSW 15 35917203 missense probably damaging 1.00
R8303:Vps13b UTSW 15 35639917 missense probably damaging 1.00
R8311:Vps13b UTSW 15 35886954 missense probably benign 0.37
R8443:Vps13b UTSW 15 35455100 missense probably benign
R8494:Vps13b UTSW 15 35422448 missense probably damaging 0.99
R8499:Vps13b UTSW 15 35841320 missense probably damaging 1.00
R8506:Vps13b UTSW 15 35446745 missense probably benign 0.31
R8559:Vps13b UTSW 15 35876642 missense probably damaging 1.00
R8686:Vps13b UTSW 15 35925389 missense probably damaging 0.99
R8782:Vps13b UTSW 15 35422337 missense possibly damaging 0.93
R8806:Vps13b UTSW 15 35472066 critical splice donor site probably benign
R8824:Vps13b UTSW 15 35533299 missense probably damaging 0.99
R9024:Vps13b UTSW 15 35923324 missense probably damaging 0.97
R9038:Vps13b UTSW 15 35875785 missense possibly damaging 0.70
R9054:Vps13b UTSW 15 35422391 missense probably damaging 1.00
R9091:Vps13b UTSW 15 35770773 missense probably benign 0.13
R9129:Vps13b UTSW 15 35448647 missense probably damaging 1.00
R9214:Vps13b UTSW 15 35623746 missense probably damaging 0.99
R9237:Vps13b UTSW 15 35841333 missense probably damaging 1.00
R9256:Vps13b UTSW 15 35623779 missense possibly damaging 0.95
R9270:Vps13b UTSW 15 35770773 missense probably benign 0.13
R9279:Vps13b UTSW 15 35572144 missense probably damaging 0.97
R9291:Vps13b UTSW 15 35846913 missense probably damaging 1.00
R9342:Vps13b UTSW 15 35455054 missense possibly damaging 0.94
R9404:Vps13b UTSW 15 35876419 missense probably damaging 1.00
R9488:Vps13b UTSW 15 35447734 missense possibly damaging 0.77
R9509:Vps13b UTSW 15 35841311 missense possibly damaging 0.79
R9610:Vps13b UTSW 15 35642409 missense possibly damaging 0.85
R9611:Vps13b UTSW 15 35642409 missense possibly damaging 0.85
R9658:Vps13b UTSW 15 35623628 missense probably benign 0.00
R9674:Vps13b UTSW 15 35607234 missense probably damaging 0.98
R9696:Vps13b UTSW 15 35674887 missense possibly damaging 0.56
R9767:Vps13b UTSW 15 35910257 missense probably damaging 1.00
R9797:Vps13b UTSW 15 35674876 missense probably damaging 1.00
RF020:Vps13b UTSW 15 35925406 missense probably null 1.00
X0026:Vps13b UTSW 15 35910646 missense probably damaging 1.00
X0028:Vps13b UTSW 15 35709431 missense probably benign 0.00
Z1177:Vps13b UTSW 15 35668885 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTGGTAGCTACTAGACTTGTAGC -3'
(R):5'- GCATCACAGTTGAAATAACCAGATAGG -3'

Sequencing Primer
(F):5'- AGCTACTAGACTTGTAGCTAATTGAG -3'
(R):5'- CTTAAACTGCTATTAACCTCCTGTAG -3'
Posted On 2016-06-21