Incidental Mutation 'R5153:Ext1'
ID395561
Institutional Source Beutler Lab
Gene Symbol Ext1
Ensembl Gene ENSMUSG00000061731
Gene Nameexostoses (multiple) 1
Synonyms
MMRRC Submission 042735-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5153 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location53064038-53346159 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 53075817 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Leucine at position 612 (W612L)
Ref Sequence ENSEMBL: ENSMUSP00000076505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077273] [ENSMUST00000133362]
Predicted Effect probably damaging
Transcript: ENSMUST00000077273
AA Change: W612L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000076505
Gene: ENSMUSG00000061731
AA Change: W612L

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
low complexity region 29 41 N/A INTRINSIC
Pfam:Exostosin 110 396 6e-64 PFAM
Pfam:Glyco_transf_64 480 729 1.1e-106 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133362
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an endoplasmic reticulum-resident type II transmembrane glycosyltransferase involved in the chain elongation step of heparan sulfate biosynthesis. Mutations in this gene cause the type I form of multiple exostoses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display a lethal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik A T 11: 99,837,247 C257S unknown Het
4930596D02Rik C A 14: 35,810,255 R121L probably benign Het
5330417C22Rik A T 3: 108,472,747 Y349N possibly damaging Het
8030411F24Rik A G 2: 148,783,440 Q98R probably benign Het
9430007A20Rik T A 4: 144,522,267 M68K probably benign Het
Acin1 A G 14: 54,645,613 V194A probably benign Het
Acsm1 T C 7: 119,640,727 I298T possibly damaging Het
Aoc1 A G 6: 48,908,747 N729D probably benign Het
Apobr C T 7: 126,587,732 T20I possibly damaging Het
Arsb A G 13: 93,940,598 E491G probably benign Het
AW209491 C G 13: 14,637,179 Q206E probably benign Het
Camsap1 A T 2: 25,933,618 N1473K probably damaging Het
Casp8 A G 1: 58,844,845 Q457R probably benign Het
Ccdc154 G A 17: 25,168,341 A350T probably damaging Het
Cecr2 A G 6: 120,734,560 E183G probably benign Het
Cep295 A T 9: 15,357,629 S39T probably benign Het
Cep350 A T 1: 155,935,946 I416K probably damaging Het
Cidea C T 18: 67,367,420 T184M probably damaging Het
Cnot10 G A 9: 114,613,735 A468V probably damaging Het
Defb22 A T 2: 152,485,802 N154K unknown Het
Dnah17 A T 11: 118,082,974 C1915* probably null Het
Dnah2 T C 11: 69,520,933 T288A possibly damaging Het
Dopey2 T A 16: 93,774,003 M1512K probably damaging Het
Dsp T G 13: 38,182,306 I572S probably damaging Het
Eepd1 A G 9: 25,586,753 H378R probably benign Het
Emilin2 A G 17: 71,273,502 M743T possibly damaging Het
F2rl2 A G 13: 95,697,112 T17A probably benign Het
Fbxl8 T G 8: 105,267,107 C32G probably damaging Het
Fbxw17 A G 13: 50,419,861 T38A probably damaging Het
Flii A T 11: 60,716,686 L882Q possibly damaging Het
Focad T G 4: 88,359,884 S1197A unknown Het
Gm6970 A G 19: 47,170,917 V73A probably damaging Het
Heatr5b G A 17: 78,795,107 R1281* probably null Het
Khdc3 A G 9: 73,103,438 Q190R probably benign Het
Krt9 T A 11: 100,191,242 D244V probably damaging Het
Ldhd T C 8: 111,627,092 E463G probably benign Het
Lig4 A T 8: 9,973,003 V259E possibly damaging Het
Luc7l3 A T 11: 94,295,980 probably benign Het
Man1a2 T C 3: 100,656,263 E22G probably damaging Het
Mmp23 T G 4: 155,651,340 D258A probably damaging Het
Msantd2 C T 9: 37,523,213 R250* probably null Het
Mynn T C 3: 30,611,589 S457P probably benign Het
Nectin1 C T 9: 43,803,498 H50Y probably damaging Het
Olfr1256 G A 2: 89,835,234 T237I possibly damaging Het
Olfr516 T C 7: 108,845,699 I104V probably benign Het
Olfr709-ps1 C T 7: 106,926,569 V297M possibly damaging Het
Olfr804 A G 10: 129,705,157 N93S probably benign Het
Pfkfb2 G A 1: 130,701,790 T303M probably damaging Het
Pkhd1l1 A G 15: 44,505,309 D841G probably benign Het
Plxna4 A T 6: 32,224,159 probably null Het
Podnl1 C T 8: 84,130,643 H294Y probably benign Het
Ppig T A 2: 69,749,650 D509E unknown Het
Ppp1r16a T A 15: 76,694,396 Y433* probably null Het
Prdm1 A C 10: 44,450,225 V134G possibly damaging Het
Prx T C 7: 27,518,476 S940P probably damaging Het
Ptprd C T 4: 76,012,102 V731I probably damaging Het
Qk A G 17: 10,238,891 probably null Het
Rassf6 T C 5: 90,606,840 K206R possibly damaging Het
Rdh16f2 G A 10: 127,876,255 E194K possibly damaging Het
Rims1 C A 1: 22,483,247 G457* probably null Het
Ripk1 T G 13: 34,013,296 I123R probably damaging Het
Rnf111 A T 9: 70,476,140 S170R probably benign Het
Shc3 A T 13: 51,461,377 F181L probably damaging Het
Siglec1 A C 2: 131,085,577 V103G probably damaging Het
Slc26a11 G T 11: 119,377,259 A488S possibly damaging Het
Smoc2 A T 17: 14,336,579 T97S probably damaging Het
Son T C 16: 91,655,022 I219T possibly damaging Het
Sptbn1 A T 11: 30,121,510 I1474N possibly damaging Het
Syt16 A T 12: 74,222,768 D127V possibly damaging Het
Tet1 G T 10: 62,878,578 N479K possibly damaging Het
Thsd7a G A 6: 12,338,655 A1192V probably benign Het
Tmed3 G A 9: 89,699,772 R213* probably null Het
Traj57 A G 14: 54,158,559 probably benign Het
Trpv1 G T 11: 73,238,516 R86S probably benign Het
Usp48 T A 4: 137,616,362 F434L possibly damaging Het
Vmn2r59 A C 7: 42,042,410 probably null Het
Vmn2r71 T A 7: 85,619,222 I211N possibly damaging Het
Vps13b T A 15: 35,422,453 D186E probably damaging Het
Vps33a A G 5: 123,558,628 S321P probably damaging Het
Wdr12 A T 1: 60,094,511 D19E probably benign Het
Zc3h12c A G 9: 52,126,647 F278L probably damaging Het
Zpld1 T C 16: 55,246,644 T183A probably damaging Het
Zswim2 G T 2: 83,939,666 T68K possibly damaging Het
Other mutations in Ext1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00710:Ext1 APN 15 53344873 missense probably damaging 1.00
IGL02081:Ext1 APN 15 53073446 nonsense probably null
IGL03147:Ext1 UTSW 15 53088072 missense probably damaging 0.98
R0047:Ext1 UTSW 15 53345146 missense probably benign
R0047:Ext1 UTSW 15 53345146 missense probably benign
R0437:Ext1 UTSW 15 53106106 missense probably damaging 1.00
R0881:Ext1 UTSW 15 53344483 missense probably benign 0.23
R1882:Ext1 UTSW 15 53075792 missense probably damaging 1.00
R2135:Ext1 UTSW 15 53101744 missense possibly damaging 0.88
R2175:Ext1 UTSW 15 53068728 missense probably damaging 1.00
R2762:Ext1 UTSW 15 53344927 missense probably benign 0.29
R3162:Ext1 UTSW 15 53344604 missense possibly damaging 0.82
R3162:Ext1 UTSW 15 53344604 missense possibly damaging 0.82
R3752:Ext1 UTSW 15 53075910 missense probably damaging 1.00
R3815:Ext1 UTSW 15 53345089 missense probably benign 0.05
R4096:Ext1 UTSW 15 53073357 missense probably damaging 1.00
R4298:Ext1 UTSW 15 53345125 missense probably benign 0.02
R4362:Ext1 UTSW 15 53107591 intron probably benign
R4550:Ext1 UTSW 15 53101786 missense probably damaging 0.99
R4647:Ext1 UTSW 15 53089987 missense possibly damaging 0.95
R4648:Ext1 UTSW 15 53089987 missense possibly damaging 0.95
R4871:Ext1 UTSW 15 53092377 missense probably benign 0.37
R4954:Ext1 UTSW 15 53344492 missense probably damaging 1.00
R5010:Ext1 UTSW 15 53092412 missense probably damaging 1.00
R5155:Ext1 UTSW 15 53075817 missense probably damaging 1.00
R5328:Ext1 UTSW 15 53075817 missense probably damaging 1.00
R5385:Ext1 UTSW 15 53075817 missense probably damaging 1.00
R5542:Ext1 UTSW 15 53075817 missense probably damaging 1.00
R5555:Ext1 UTSW 15 53088143 missense probably damaging 1.00
R5779:Ext1 UTSW 15 53344553 missense probably damaging 0.99
R5874:Ext1 UTSW 15 53101752 missense possibly damaging 0.61
R6401:Ext1 UTSW 15 53106097 missense possibly damaging 0.94
R6604:Ext1 UTSW 15 53083159 missense probably damaging 0.99
R6847:Ext1 UTSW 15 53345154 missense probably benign
R6885:Ext1 UTSW 15 53101692 missense probably damaging 1.00
R7212:Ext1 UTSW 15 53345162 missense probably benign 0.00
R7315:Ext1 UTSW 15 53073387 missense probably damaging 1.00
R7361:Ext1 UTSW 15 53344723 missense probably damaging 1.00
R7474:Ext1 UTSW 15 53344489 missense probably damaging 0.98
R7853:Ext1 UTSW 15 53107485 missense probably damaging 0.96
R7860:Ext1 UTSW 15 53089939 missense possibly damaging 0.84
R8013:Ext1 UTSW 15 53075887 missense possibly damaging 0.78
R8014:Ext1 UTSW 15 53075887 missense possibly damaging 0.78
R8725:Ext1 UTSW 15 53344669 missense possibly damaging 0.91
R8888:Ext1 UTSW 15 53092327 missense probably damaging 1.00
X0021:Ext1 UTSW 15 53345273 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCAGTTGTTAGAAATCTCAGCTCC -3'
(R):5'- TCGAAACAGTTGTGGGACTCC -3'

Sequencing Primer
(F):5'- TCAGTGTGTAAGAGCACCCGAC -3'
(R):5'- GGGACTCCACGTTATGAATTAGC -3'
Posted On2016-06-21