Incidental Mutation 'R5164:Fam126b'
ID395575
Institutional Source Beutler Lab
Gene Symbol Fam126b
Ensembl Gene ENSMUSG00000038174
Gene Namefamily with sequence similarity 126, member B
SynonymsD1Ertd53e
MMRRC Submission 042745-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.710) question?
Stock #R5164 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location58522806-58586323 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58535438 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 315 (T315A)
Ref Sequence ENSEMBL: ENSMUSP00000123728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038372] [ENSMUST00000097724] [ENSMUST00000161600] [ENSMUST00000187717]
Predicted Effect probably benign
Transcript: ENSMUST00000038372
AA Change: T315A

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000038718
Gene: ENSMUSG00000038174
AA Change: T315A

DomainStartEndE-ValueType
Pfam:Hyccin 20 330 1.7e-137 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097724
AA Change: T315A

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000095331
Gene: ENSMUSG00000038174
AA Change: T315A

DomainStartEndE-ValueType
Pfam:Hyccin 22 330 3.3e-126 PFAM
low complexity region 374 399 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161600
AA Change: T315A

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000123728
Gene: ENSMUSG00000038174
AA Change: T315A

DomainStartEndE-ValueType
Pfam:Hyccin 20 330 1.7e-137 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000187717
Meta Mutation Damage Score 0.0701 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (49/50)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,435,674 H4637Q probably benign Het
Akap6 A G 12: 53,142,466 H2221R probably benign Het
Arsj A T 3: 126,438,159 M185L probably benign Het
Ccdc177 T C 12: 80,758,562 T313A unknown Het
Cdkal1 A T 13: 29,625,719 L214H probably damaging Het
Cfap44 T A 16: 44,481,389 I1830N probably damaging Het
Cfap65 T C 1: 74,926,516 K445R probably damaging Het
Chrnb3 T A 8: 27,394,132 I299N probably damaging Het
Cse1l C A 2: 166,944,428 D826E probably benign Het
Cwf19l2 T C 9: 3,475,511 V816A probably damaging Het
Dnah5 A T 15: 28,408,292 E3474D probably benign Het
Dock5 A T 14: 67,817,661 Y585* probably null Het
Ebf2 T C 14: 67,390,521 S322P possibly damaging Het
Epha8 T C 4: 136,945,672 E267G possibly damaging Het
Fkbp5 A G 17: 28,437,990 probably null Het
Gbp4 T A 5: 105,136,877 K49* probably null Het
Gm13212 T C 4: 145,622,205 Y71H probably damaging Het
Gramd4 A T 15: 86,100,831 T98S probably benign Het
H2-Ke6 A G 17: 34,026,978 probably benign Het
Hectd1 C A 12: 51,827,489 M1I probably null Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Keg1 A G 19: 12,714,680 probably benign Het
Lilra6 A T 7: 3,914,881 V88E probably damaging Het
Mast1 A G 8: 84,913,518 probably benign Het
Mdn1 A G 4: 32,759,011 probably null Het
Nrd1 C T 4: 109,039,717 T511I probably damaging Het
Olfr1058 T C 2: 86,385,471 T316A probably benign Het
Olfr1204 T A 2: 88,852,570 L207I probably benign Het
Olfr478 G A 7: 108,032,280 T21I possibly damaging Het
Pms1 A G 1: 53,207,640 V301A probably damaging Het
Pnisr A T 4: 21,859,237 Q144L possibly damaging Het
Pp2d1 G T 17: 53,508,070 T542K probably benign Het
Ppargc1b A T 18: 61,302,644 C922S probably damaging Het
Ptprd T C 4: 76,100,758 probably null Het
Runx3 T C 4: 135,121,130 S9P possibly damaging Het
Serpina1b A G 12: 103,732,087 S168P probably benign Het
Slc14a2 G A 18: 78,157,272 A722V probably damaging Het
Slc23a2 T A 2: 132,075,450 probably benign Het
Slc47a1 A G 11: 61,353,060 probably null Het
Tcf20 A G 15: 82,856,603 S216P probably damaging Het
Tpst1 T A 5: 130,102,001 I104N probably damaging Het
Ttc25 G A 11: 100,571,520 W506* probably null Het
Ufm1 A C 3: 53,857,927 probably benign Het
Unkl A G 17: 25,213,109 probably null Het
Usf3 T C 16: 44,218,180 S1008P probably damaging Het
Ythdf3 T C 3: 16,183,513 V6A possibly damaging Het
Zc3h3 A T 15: 75,777,026 S752R probably benign Het
Other mutations in Fam126b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Fam126b APN 1 58540253 splice site probably benign
IGL00468:Fam126b APN 1 58530232 missense probably benign 0.25
IGL00701:Fam126b APN 1 58535482 missense possibly damaging 0.59
IGL00795:Fam126b APN 1 58552179 missense probably damaging 1.00
IGL02023:Fam126b APN 1 58530115 missense possibly damaging 0.53
IGL02501:Fam126b APN 1 58540191 missense probably damaging 1.00
IGL02657:Fam126b APN 1 58535402 missense probably damaging 1.00
IGL02970:Fam126b APN 1 58539617 missense probably damaging 1.00
IGL03221:Fam126b APN 1 58540186 missense probably benign 0.00
IGL03240:Fam126b APN 1 58529917 missense probably damaging 1.00
PIT4812001:Fam126b UTSW 1 58548703 missense possibly damaging 0.78
R0455:Fam126b UTSW 1 58534479 splice site probably benign
R1479:Fam126b UTSW 1 58552268 nonsense probably null
R1529:Fam126b UTSW 1 58539607 missense probably benign 0.00
R4275:Fam126b UTSW 1 58529933 missense probably benign
R6332:Fam126b UTSW 1 58529875 missense probably damaging 0.99
R6352:Fam126b UTSW 1 58557312 missense probably damaging 1.00
R6549:Fam126b UTSW 1 58539600 missense probably benign 0.03
R7034:Fam126b UTSW 1 58535537 missense probably benign 0.17
R7036:Fam126b UTSW 1 58535537 missense probably benign 0.17
R7100:Fam126b UTSW 1 58534494 missense possibly damaging 0.94
R7237:Fam126b UTSW 1 58529948 nonsense probably null
R7378:Fam126b UTSW 1 58530034 missense probably benign 0.00
R7403:Fam126b UTSW 1 58548702 missense possibly damaging 0.59
R8015:Fam126b UTSW 1 58535482 missense possibly damaging 0.59
R8249:Fam126b UTSW 1 58534637 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TCTCCCACAGTGCTCATACATG -3'
(R):5'- AGTACAGGTTAAAAGTCTGTGTTGG -3'

Sequencing Primer
(F):5'- TTTTCCAGCTAATAGGCTTAAAGC -3'
(R):5'- CTTCACAAGAAGGCCAGA -3'
Posted On2016-06-21