Incidental Mutation 'R0449:Lrrk2'
ID39558
Institutional Source Beutler Lab
Gene Symbol Lrrk2
Ensembl Gene ENSMUSG00000036273
Gene Nameleucine-rich repeat kinase 2
Synonyms9330188B09Rik, 4921513O20Rik, LOC381026, cI-46, D630001M17Rik
MMRRC Submission 038649-MU
Accession Numbers

Genbank: NM_025730; MGI: 1913975

Is this an essential gene? Possibly non essential (E-score: 0.484) question?
Stock #R0449 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location91673175-91816120 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91750275 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 1414 (L1414P)
Ref Sequence ENSEMBL: ENSMUSP00000052584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060642]
Predicted Effect probably damaging
Transcript: ENSMUST00000060642
AA Change: L1414P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052584
Gene: ENSMUSG00000036273
AA Change: L1414P

DomainStartEndE-ValueType
low complexity region 138 156 N/A INTRINSIC
low complexity region 332 347 N/A INTRINSIC
ANK 708 737 3.95e1 SMART
ANK 770 800 4.58e2 SMART
low complexity region 890 901 N/A INTRINSIC
low complexity region 953 966 N/A INTRINSIC
low complexity region 971 979 N/A INTRINSIC
LRR 1010 1033 9.96e-1 SMART
LRR 1034 1057 8.01e0 SMART
LRR 1082 1105 2.45e0 SMART
LRR 1128 1151 9.3e-1 SMART
LRR 1195 1219 3.24e0 SMART
LRR 1244 1266 3.87e1 SMART
LRR 1267 1291 4.98e1 SMART
Pfam:Roc 1336 1456 4.9e-32 PFAM
Pfam:Ras 1336 1489 3.3e-17 PFAM
Pfam:COR 1524 1740 4e-28 PFAM
Pfam:Pkinase 1881 2132 4.7e-40 PFAM
Pfam:Pkinase_Tyr 1882 2132 6.8e-39 PFAM
WD40 2231 2276 3.09e-1 SMART
WD40 2401 2438 1.37e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140734
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the leucine-rich repeat kinase family and encodes a protein with an ankryin repeat region, a leucine-rich repeat (LRR) domain, a kinase domain, a DFG-like motif, a RAS domain, a GTPase domain, a MLK-like domain, and a WD40 domain. The protein is present largely in the cytoplasm but also associates with the mitochondrial outer membrane. Mutations in this gene have been associated with Parkinson disease-8. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit impaired response to dopamine, amphetamine, and quinpirole. Mice homozygous for one knock-out allele exhibit increased neurite growth. Mice homozygous for different knock-out alleles exhibit alopecia due to excessive grooming or kdiney atrophy. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(6) Targeted, other(1)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 A T 5: 8,939,885 R813* probably null Het
Accsl T A 2: 93,866,074 I60F probably benign Het
Adam29 C T 8: 55,872,681 G246D probably benign Het
Ankrd13c A G 3: 157,991,714 I319V probably benign Het
B020004J07Rik T C 4: 101,836,961 S242G probably benign Het
Bag6 T G 17: 35,141,466 V327G probably damaging Het
Barhl1 C T 2: 28,915,292 A130T probably benign Het
Bend4 T C 5: 67,398,240 D541G probably damaging Het
Birc6 A C 17: 74,692,295 T4673P probably damaging Het
Ccdc81 T C 7: 89,890,471 R186G probably damaging Het
Cdyl2 A G 8: 116,583,192 F342L probably damaging Het
Chd3 C A 11: 69,357,541 V748L probably damaging Het
CN725425 G T 15: 91,238,944 R72I possibly damaging Het
Col22a1 A G 15: 71,962,671 probably null Het
Cops3 A G 11: 59,818,417 probably null Het
Ctnnd1 G T 2: 84,603,262 Q940K possibly damaging Het
Dtnb C T 12: 3,591,971 Q45* probably null Het
Efr3a T A 15: 65,842,704 I280K probably damaging Het
Eml6 A C 11: 29,893,213 V167G probably benign Het
Fam83c T A 2: 155,830,295 M407L probably benign Het
Fasn T C 11: 120,811,068 T1862A probably benign Het
Fbxl6 A G 15: 76,535,955 I486T probably damaging Het
Gpr182 A G 10: 127,750,696 Y129H probably damaging Het
Gpr75 A G 11: 30,892,456 S454G probably damaging Het
Hectd4 G A 5: 121,364,590 probably null Het
Hsf4 A G 8: 105,275,590 T411A probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Il4 A T 11: 53,618,605 M1K probably null Het
Ints11 G T 4: 155,887,948 R463L probably benign Het
Ints4 G A 7: 97,529,223 E677K probably damaging Het
Klk1b11 G A 7: 43,997,792 C50Y probably damaging Het
Krt14 C A 11: 100,207,395 G21C unknown Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
L3mbtl2 C T 15: 81,668,741 A125V probably damaging Het
Lama3 A G 18: 12,500,512 probably null Het
Matn2 T C 15: 34,428,541 S684P probably damaging Het
Mga T A 2: 119,941,381 V1574D probably damaging Het
Mia2 T C 12: 59,172,594 probably null Het
Mrpl21 T A 19: 3,292,459 probably benign Het
Msh5 T A 17: 35,041,482 Q266L probably benign Het
Mybpc1 C A 10: 88,540,960 C758F probably damaging Het
Myo15 G A 11: 60,509,596 A2932T possibly damaging Het
Nbas T A 12: 13,519,108 I2021K probably benign Het
Neurl4 T C 11: 69,905,567 S424P probably damaging Het
Olfr16 T A 1: 172,957,398 V201E probably damaging Het
Olfr322 A C 11: 58,665,963 I135L probably benign Het
Olfr782 A G 10: 129,351,234 M224V probably benign Het
Olfr829 T C 9: 18,856,649 M8T probably benign Het
Olfr850 T A 9: 19,478,092 I53F possibly damaging Het
Phlpp1 C T 1: 106,350,578 R907W probably damaging Het
Pigg T C 5: 108,336,411 V508A probably benign Het
Pkhd1l1 T G 15: 44,501,519 Y685D probably damaging Het
Polr3a A T 14: 24,484,466 I34N probably damaging Het
Prex1 A G 2: 166,569,377 V1434A probably benign Het
Ptprh T A 7: 4,598,006 D124V probably damaging Het
Rad54b T A 4: 11,606,131 I513N probably benign Het
Rbm12b1 A G 4: 12,145,507 N493S probably benign Het
Rfx7 A T 9: 72,610,304 probably null Het
Serpini1 A G 3: 75,613,341 K82E probably benign Het
Slc27a6 T G 18: 58,609,165 probably null Het
Slc35f2 G T 9: 53,816,917 L358F probably damaging Het
Slc45a1 A C 4: 150,643,305 I158M probably damaging Het
Slurp2 G A 15: 74,743,106 P62L probably damaging Het
Sspo C T 6: 48,466,740 H1949Y probably damaging Het
Tiam1 A T 16: 89,837,827 V865E possibly damaging Het
Tlr4 A C 4: 66,839,620 I217L probably damaging Het
Top1 C T 2: 160,712,708 R460* probably null Het
Trpm3 T A 19: 22,988,054 S1638T probably benign Het
Tubgcp5 C T 7: 55,823,567 R798C probably benign Het
Vars T G 17: 35,012,727 probably null Het
Xylt2 A G 11: 94,666,333 Y111H probably benign Het
Zbed5 G A 5: 129,901,726 G172D probably damaging Het
Zfp53 C T 17: 21,508,833 T376I probably benign Het
Zfp937 G T 2: 150,239,546 V499L probably benign Het
Zyx T A 6: 42,351,313 L152Q probably damaging Het
Other mutations in Lrrk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Lrrk2 APN 15 91747799 missense possibly damaging 0.90
IGL00542:Lrrk2 APN 15 91699943 missense probably benign
IGL00770:Lrrk2 APN 15 91801833 splice site probably benign
IGL00774:Lrrk2 APN 15 91801833 splice site probably benign
IGL00791:Lrrk2 APN 15 91779841 missense probably damaging 1.00
IGL00827:Lrrk2 APN 15 91755790 missense probably damaging 1.00
IGL00843:Lrrk2 APN 15 91757058 missense possibly damaging 0.58
IGL01109:Lrrk2 APN 15 91738832 missense probably damaging 1.00
IGL01293:Lrrk2 APN 15 91726137 missense probably benign 0.21
IGL01296:Lrrk2 APN 15 91683142 missense probably benign
IGL01301:Lrrk2 APN 15 91767339 missense probably damaging 1.00
IGL01360:Lrrk2 APN 15 91700569 splice site probably null
IGL01465:Lrrk2 APN 15 91728925 missense probably benign 0.21
IGL01529:Lrrk2 APN 15 91812313 missense possibly damaging 0.92
IGL01557:Lrrk2 APN 15 91699989 missense probably damaging 1.00
IGL01560:Lrrk2 APN 15 91774988 missense probably benign 0.33
IGL01991:Lrrk2 APN 15 91779946 missense probably damaging 0.99
IGL02003:Lrrk2 APN 15 91731491 missense probably damaging 0.99
IGL02325:Lrrk2 APN 15 91726308 critical splice donor site probably null
IGL02711:Lrrk2 APN 15 91685822 missense possibly damaging 0.71
IGL02869:Lrrk2 APN 15 91750277 missense probably damaging 1.00
IGL03104:Lrrk2 APN 15 91747755 missense possibly damaging 0.68
IGL03179:Lrrk2 APN 15 91700578 missense probably damaging 1.00
IGL03395:Lrrk2 APN 15 91797414 splice site probably null
3-1:Lrrk2 UTSW 15 91801934 missense probably benign 0.01
ANU18:Lrrk2 UTSW 15 91767339 missense probably damaging 1.00
H8562:Lrrk2 UTSW 15 91673358 missense probably benign
H8786:Lrrk2 UTSW 15 91673358 missense probably benign
IGL02835:Lrrk2 UTSW 15 91814660 critical splice acceptor site probably null
R0014:Lrrk2 UTSW 15 91802045 splice site probably benign
R0014:Lrrk2 UTSW 15 91802045 splice site probably benign
R0078:Lrrk2 UTSW 15 91734009 missense probably benign 0.01
R0100:Lrrk2 UTSW 15 91745796 missense probably damaging 1.00
R0282:Lrrk2 UTSW 15 91778414 splice site probably benign
R0448:Lrrk2 UTSW 15 91709305 missense probably damaging 0.99
R0610:Lrrk2 UTSW 15 91815416 missense probably benign
R0617:Lrrk2 UTSW 15 91752278 missense probably benign 0.00
R0632:Lrrk2 UTSW 15 91796028 missense probably damaging 0.98
R0639:Lrrk2 UTSW 15 91772996 missense probably benign 0.03
R0661:Lrrk2 UTSW 15 91787016 missense probably damaging 1.00
R0666:Lrrk2 UTSW 15 91757070 critical splice donor site probably null
R0764:Lrrk2 UTSW 15 91775046 splice site probably null
R0766:Lrrk2 UTSW 15 91699895 missense probably damaging 1.00
R0845:Lrrk2 UTSW 15 91755962 missense probably benign 0.22
R0940:Lrrk2 UTSW 15 91729081 missense possibly damaging 0.83
R0970:Lrrk2 UTSW 15 91729169 missense probably benign 0.22
R1080:Lrrk2 UTSW 15 91673689 missense probably benign 0.01
R1114:Lrrk2 UTSW 15 91700468 nonsense probably null
R1223:Lrrk2 UTSW 15 91673635 missense probably benign 0.00
R1289:Lrrk2 UTSW 15 91812360 missense probably benign 0.00
R1296:Lrrk2 UTSW 15 91728920 missense probably damaging 1.00
R1312:Lrrk2 UTSW 15 91699895 missense probably damaging 1.00
R1637:Lrrk2 UTSW 15 91734058 missense probably benign
R1773:Lrrk2 UTSW 15 91779981 missense possibly damaging 0.96
R1809:Lrrk2 UTSW 15 91699892 missense possibly damaging 0.86
R1839:Lrrk2 UTSW 15 91683134 missense probably benign 0.00
R1946:Lrrk2 UTSW 15 91736661 splice site probably null
R2160:Lrrk2 UTSW 15 91796060 missense probably damaging 1.00
R2232:Lrrk2 UTSW 15 91764716 missense probably benign 0.05
R2419:Lrrk2 UTSW 15 91797526 splice site probably benign
R2516:Lrrk2 UTSW 15 91755927 missense probably benign
R3110:Lrrk2 UTSW 15 91814695 missense probably benign 0.02
R3112:Lrrk2 UTSW 15 91814695 missense probably benign 0.02
R3801:Lrrk2 UTSW 15 91737111 missense probably benign
R3842:Lrrk2 UTSW 15 91755916 missense probably benign 0.01
R3903:Lrrk2 UTSW 15 91747700 missense probably damaging 1.00
R3903:Lrrk2 UTSW 15 91747701 missense probably damaging 1.00
R3930:Lrrk2 UTSW 15 91767461 critical splice donor site probably null
R3937:Lrrk2 UTSW 15 91778504 missense probably damaging 0.98
R3938:Lrrk2 UTSW 15 91712780 missense possibly damaging 0.69
R3938:Lrrk2 UTSW 15 91778504 missense probably damaging 0.98
R3982:Lrrk2 UTSW 15 91709284 missense probably benign 0.22
R4125:Lrrk2 UTSW 15 91815483 missense probably benign 0.01
R4130:Lrrk2 UTSW 15 91755794 missense probably benign 0.19
R4296:Lrrk2 UTSW 15 91699895 missense probably damaging 1.00
R4465:Lrrk2 UTSW 15 91747820 missense probably damaging 0.96
R4478:Lrrk2 UTSW 15 91723188 missense probably damaging 1.00
R4517:Lrrk2 UTSW 15 91705120 missense probably benign
R4539:Lrrk2 UTSW 15 91729142 missense possibly damaging 0.86
R4654:Lrrk2 UTSW 15 91765681 missense probably damaging 0.96
R4710:Lrrk2 UTSW 15 91699927 missense possibly damaging 0.88
R4722:Lrrk2 UTSW 15 91688901 missense probably damaging 1.00
R4723:Lrrk2 UTSW 15 91764759 missense probably damaging 1.00
R4732:Lrrk2 UTSW 15 91688849 missense probably damaging 1.00
R4732:Lrrk2 UTSW 15 91765747 missense probably damaging 1.00
R4733:Lrrk2 UTSW 15 91688849 missense probably damaging 1.00
R4733:Lrrk2 UTSW 15 91765747 missense probably damaging 1.00
R4787:Lrrk2 UTSW 15 91712828 missense probably benign
R4945:Lrrk2 UTSW 15 91804920 missense probably benign 0.02
R4948:Lrrk2 UTSW 15 91803389 missense probably benign 0.20
R5000:Lrrk2 UTSW 15 91749878 missense probably damaging 1.00
R5031:Lrrk2 UTSW 15 91700619 missense possibly damaging 0.50
R5067:Lrrk2 UTSW 15 91765790 missense probably benign 0.01
R5245:Lrrk2 UTSW 15 91796089 missense probably damaging 1.00
R5341:Lrrk2 UTSW 15 91772858 missense probably damaging 1.00
R5460:Lrrk2 UTSW 15 91814644 intron probably null
R5551:Lrrk2 UTSW 15 91812350 missense probably benign
R5574:Lrrk2 UTSW 15 91787016 missense probably damaging 1.00
R5577:Lrrk2 UTSW 15 91765745 missense probably damaging 1.00
R5685:Lrrk2 UTSW 15 91803301 nonsense probably null
R5712:Lrrk2 UTSW 15 91702222 nonsense probably null
R5728:Lrrk2 UTSW 15 91774974 missense probably benign 0.36
R5782:Lrrk2 UTSW 15 91702183 missense probably damaging 1.00
R5788:Lrrk2 UTSW 15 91764648 missense possibly damaging 0.55
R5821:Lrrk2 UTSW 15 91709390 critical splice donor site probably null
R5852:Lrrk2 UTSW 15 91755949 missense probably damaging 1.00
R5934:Lrrk2 UTSW 15 91734046 missense probably benign 0.00
R5935:Lrrk2 UTSW 15 91745831 missense probably benign 0.14
R5979:Lrrk2 UTSW 15 91772945 missense possibly damaging 0.47
R6101:Lrrk2 UTSW 15 91723135 missense probably benign 0.10
R6114:Lrrk2 UTSW 15 91747826 missense probably benign 0.33
R6259:Lrrk2 UTSW 15 91702247 missense probably benign 0.00
R6376:Lrrk2 UTSW 15 91742266 missense possibly damaging 0.89
R6417:Lrrk2 UTSW 15 91812346 missense probably benign 0.03
R6420:Lrrk2 UTSW 15 91812346 missense probably benign 0.03
R6737:Lrrk2 UTSW 15 91723218 missense possibly damaging 0.50
R7056:Lrrk2 UTSW 15 91774995 nonsense probably null
R7072:Lrrk2 UTSW 15 91801920 missense probably benign 0.03
R7109:Lrrk2 UTSW 15 91764782 missense probably damaging 1.00
R7128:Lrrk2 UTSW 15 91801885 missense probably benign
R7144:Lrrk2 UTSW 15 91734055 missense possibly damaging 0.54
R7187:Lrrk2 UTSW 15 91757001 missense possibly damaging 0.92
R7270:Lrrk2 UTSW 15 91700441 missense probably benign 0.01
R7356:Lrrk2 UTSW 15 91738744 missense probably benign 0.07
R7360:Lrrk2 UTSW 15 91731655 critical splice donor site probably null
R7373:Lrrk2 UTSW 15 91700004 critical splice donor site probably null
R7465:Lrrk2 UTSW 15 91767340 missense probably damaging 1.00
R7477:Lrrk2 UTSW 15 91812325 missense probably damaging 0.98
R7614:Lrrk2 UTSW 15 91772858 missense probably damaging 1.00
R7622:Lrrk2 UTSW 15 91812323 missense probably damaging 1.00
R7658:Lrrk2 UTSW 15 91700358 missense possibly damaging 0.91
R7679:Lrrk2 UTSW 15 91726186 missense possibly damaging 0.58
R7737:Lrrk2 UTSW 15 91815446 missense probably damaging 0.98
R7739:Lrrk2 UTSW 15 91700613 missense probably damaging 1.00
R7740:Lrrk2 UTSW 15 91767324 missense probably damaging 1.00
R7908:Lrrk2 UTSW 15 91726152 missense probably damaging 1.00
R8299:Lrrk2 UTSW 15 91673240 start gained probably benign
RF001:Lrrk2 UTSW 15 91736633 missense probably benign 0.11
X0028:Lrrk2 UTSW 15 91738851 missense probably benign 0.00
Z1088:Lrrk2 UTSW 15 91726240 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TTGCCCTCCTCCAAAGGATTTGCTG -3'
(R):5'- ACCGTAACAGGATTTCAGAGCCTAGTG -3'

Sequencing Primer
(F):5'- AAAGGATTTGCTGTGCCCC -3'
(R):5'- gagagagagggagaagggg -3'
Posted On2013-05-23