Incidental Mutation 'R5164:Cse1l'
ID 395580
Institutional Source Beutler Lab
Gene Symbol Cse1l
Ensembl Gene ENSMUSG00000002718
Gene Name chromosome segregation 1 like
Synonyms Cas, Xpo2, Capts, 2610100P18Rik
MMRRC Submission 042745-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5164 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 166747961-166788309 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 166786348 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 826 (D826E)
Ref Sequence ENSEMBL: ENSMUSP00000129983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002790] [ENSMUST00000049412] [ENSMUST00000109235] [ENSMUST00000109236] [ENSMUST00000109238] [ENSMUST00000163437] [ENSMUST00000168599] [ENSMUST00000169290] [ENSMUST00000184390]
AlphaFold Q9ERK4
Predicted Effect probably benign
Transcript: ENSMUST00000002790
AA Change: D882E

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000002790
Gene: ENSMUSG00000002718
AA Change: D882E

DomainStartEndE-ValueType
IBN_N 29 102 2e-10 SMART
Pfam:Cse1 156 526 9.2e-169 PFAM
Pfam:CAS_CSE1 527 962 1.1e-181 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000049412
SMART Domains Protein: ENSMUSP00000042626
Gene: ENSMUSG00000039536

DomainStartEndE-ValueType
Blast:DSRM 1 73 5e-21 BLAST
DSRM 97 162 9.49e-21 SMART
DSRM 199 265 5.54e-22 SMART
PDB:4DKK|A 355 469 2e-69 PDB
Blast:DSRM 401 466 3e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000109235
SMART Domains Protein: ENSMUSP00000104858
Gene: ENSMUSG00000039536

DomainStartEndE-ValueType
Blast:DSRM 1 73 5e-21 BLAST
DSRM 97 162 9.49e-21 SMART
DSRM 199 265 5.54e-22 SMART
PDB:4DKK|A 355 469 3e-69 PDB
Blast:DSRM 401 466 3e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000109236
SMART Domains Protein: ENSMUSP00000104859
Gene: ENSMUSG00000039536

DomainStartEndE-ValueType
Blast:DSRM 1 73 4e-21 BLAST
DSRM 97 162 9.49e-21 SMART
DSRM 197 263 5.54e-22 SMART
PDB:4DKK|A 353 467 3e-69 PDB
Blast:DSRM 399 464 3e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000109238
SMART Domains Protein: ENSMUSP00000104861
Gene: ENSMUSG00000039536

DomainStartEndE-ValueType
Blast:DSRM 1 73 5e-21 BLAST
DSRM 97 168 4.04e-15 SMART
DSRM 205 271 5.54e-22 SMART
Pfam:Staufen_C 364 475 5.9e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129061
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142481
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145819
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149454
Predicted Effect probably benign
Transcript: ENSMUST00000163437
AA Change: D569E

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000126757
Gene: ENSMUSG00000002718
AA Change: D569E

DomainStartEndE-ValueType
Pfam:Cse1 1 237 7.9e-105 PFAM
Pfam:CAS_CSE1 225 649 2.3e-195 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168599
AA Change: D826E

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000129983
Gene: ENSMUSG00000002718
AA Change: D826E

DomainStartEndE-ValueType
IBN_N 29 102 2e-10 SMART
Pfam:Cse1 156 256 8.6e-40 PFAM
Pfam:Cse1 255 470 7.3e-99 PFAM
Pfam:CAS_CSE1 471 906 1.3e-201 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171410
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172037
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163917
Predicted Effect probably benign
Transcript: ENSMUST00000169290
SMART Domains Protein: ENSMUSP00000128376
Gene: ENSMUSG00000002718

DomainStartEndE-ValueType
IBN_N 29 102 2e-10 SMART
Pfam:Cse1 156 389 5.2e-102 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164974
SMART Domains Protein: ENSMUSP00000128515
Gene: ENSMUSG00000002718

DomainStartEndE-ValueType
Pfam:CAS_CSE1 24 72 5.4e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184390
SMART Domains Protein: ENSMUSP00000139039
Gene: ENSMUSG00000039536

DomainStartEndE-ValueType
Blast:DSRM 1 73 4e-21 BLAST
DSRM 97 168 4.04e-15 SMART
DSRM 205 271 5.54e-22 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins that carry a nuclear localization signal (NLS) are transported into the nucleus by the importin-alpha/beta heterodimer. Importin-alpha binds the NLS, while importin-beta mediates translocation through the nuclear pore complex. After translocation, RanGTP binds importin-beta and displaces importin-alpha. Importin-alpha must then be returned to the cytoplasm, leaving the NLS protein behind. The protein encoded by this gene binds strongly to NLS-free importin-alpha, and this binding is released in the cytoplasm by the combined action of RANBP1 and RANGAP1. In addition, the encoded protein may play a role both in apoptosis and in cell proliferation. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Embryos homozygous for a targeted null mutation die prior to E5.5 of development and are morphologically disorganized and lack identifiable structures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,583,793 (GRCm39) H4637Q probably benign Het
Akap6 A G 12: 53,189,249 (GRCm39) H2221R probably benign Het
Arsj A T 3: 126,231,808 (GRCm39) M185L probably benign Het
Ccdc177 T C 12: 80,805,336 (GRCm39) T313A unknown Het
Cdkal1 A T 13: 29,809,702 (GRCm39) L214H probably damaging Het
Cfap44 T A 16: 44,301,752 (GRCm39) I1830N probably damaging Het
Cfap65 T C 1: 74,965,675 (GRCm39) K445R probably damaging Het
Chrnb3 T A 8: 27,884,160 (GRCm39) I299N probably damaging Het
Cwf19l2 T C 9: 3,475,511 (GRCm39) V816A probably damaging Het
Dnah5 A T 15: 28,408,438 (GRCm39) E3474D probably benign Het
Dock5 A T 14: 68,055,110 (GRCm39) Y585* probably null Het
Ebf2 T C 14: 67,627,970 (GRCm39) S322P possibly damaging Het
Epha8 T C 4: 136,672,983 (GRCm39) E267G possibly damaging Het
Fkbp5 A G 17: 28,656,964 (GRCm39) probably null Het
Gbp4 T A 5: 105,284,743 (GRCm39) K49* probably null Het
Gramd4 A T 15: 85,985,032 (GRCm39) T98S probably benign Het
Hectd1 C A 12: 51,874,272 (GRCm39) M1I probably null Het
Hsd17b8 A G 17: 34,245,952 (GRCm39) probably benign Het
Hycc2 T C 1: 58,574,597 (GRCm39) T315A probably benign Het
Igkv4-80 A C 6: 68,993,649 (GRCm39) S81A probably benign Het
Keg1 A G 19: 12,692,044 (GRCm39) probably benign Het
Lilra6 A T 7: 3,917,880 (GRCm39) V88E probably damaging Het
Mast1 A G 8: 85,640,147 (GRCm39) probably benign Het
Mdn1 A G 4: 32,759,011 (GRCm39) probably null Het
Nrdc C T 4: 108,896,914 (GRCm39) T511I probably damaging Het
Odad4 G A 11: 100,462,346 (GRCm39) W506* probably null Het
Or4c106 T A 2: 88,682,914 (GRCm39) L207I probably benign Het
Or5p6 G A 7: 107,631,487 (GRCm39) T21I possibly damaging Het
Or8k24 T C 2: 86,215,815 (GRCm39) T316A probably benign Het
Pms1 A G 1: 53,246,799 (GRCm39) V301A probably damaging Het
Pnisr A T 4: 21,859,237 (GRCm39) Q144L possibly damaging Het
Pp2d1 G T 17: 53,815,098 (GRCm39) T542K probably benign Het
Ppargc1b A T 18: 61,435,715 (GRCm39) C922S probably damaging Het
Ptprd T C 4: 76,018,995 (GRCm39) probably null Het
Runx3 T C 4: 134,848,441 (GRCm39) S9P possibly damaging Het
Serpina1b A G 12: 103,698,346 (GRCm39) S168P probably benign Het
Slc14a2 G A 18: 78,200,487 (GRCm39) A722V probably damaging Het
Slc23a2 T A 2: 131,917,370 (GRCm39) probably benign Het
Slc47a1 A G 11: 61,243,886 (GRCm39) probably null Het
Tcf20 A G 15: 82,740,804 (GRCm39) S216P probably damaging Het
Tpst1 T A 5: 130,130,842 (GRCm39) I104N probably damaging Het
Ufm1 A C 3: 53,765,348 (GRCm39) probably benign Het
Unkl A G 17: 25,432,083 (GRCm39) probably null Het
Usf3 T C 16: 44,038,543 (GRCm39) S1008P probably damaging Het
Ythdf3 T C 3: 16,237,677 (GRCm39) V6A possibly damaging Het
Zc3h3 A T 15: 75,648,875 (GRCm39) S752R probably benign Het
Zfp268 T C 4: 145,348,775 (GRCm39) Y71H probably damaging Het
Other mutations in Cse1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Cse1l APN 2 166,769,724 (GRCm39) missense probably damaging 1.00
IGL01306:Cse1l APN 2 166,769,428 (GRCm39) nonsense probably null
IGL01672:Cse1l APN 2 166,771,887 (GRCm39) missense probably damaging 1.00
IGL02060:Cse1l APN 2 166,772,573 (GRCm39) missense probably damaging 1.00
IGL02897:Cse1l APN 2 166,761,628 (GRCm39) missense possibly damaging 0.47
IGL03375:Cse1l APN 2 166,784,977 (GRCm39) splice site probably benign
ANU23:Cse1l UTSW 2 166,769,428 (GRCm39) nonsense probably null
PIT4585001:Cse1l UTSW 2 166,783,394 (GRCm39) missense probably damaging 1.00
R0195:Cse1l UTSW 2 166,782,008 (GRCm39) missense probably benign
R1114:Cse1l UTSW 2 166,783,123 (GRCm39) splice site probably benign
R1539:Cse1l UTSW 2 166,768,292 (GRCm39) missense probably benign 0.00
R1721:Cse1l UTSW 2 166,768,331 (GRCm39) missense probably damaging 1.00
R1779:Cse1l UTSW 2 166,782,044 (GRCm39) splice site probably null
R1913:Cse1l UTSW 2 166,764,111 (GRCm39) missense probably damaging 1.00
R2069:Cse1l UTSW 2 166,783,412 (GRCm39) missense probably benign 0.01
R2398:Cse1l UTSW 2 166,770,917 (GRCm39) missense probably damaging 1.00
R4110:Cse1l UTSW 2 166,783,970 (GRCm39) missense probably benign 0.00
R4195:Cse1l UTSW 2 166,771,899 (GRCm39) missense probably damaging 1.00
R4603:Cse1l UTSW 2 166,786,452 (GRCm39) missense probably benign 0.09
R4686:Cse1l UTSW 2 166,774,080 (GRCm39) missense probably damaging 1.00
R4867:Cse1l UTSW 2 166,768,323 (GRCm39) missense possibly damaging 0.76
R4942:Cse1l UTSW 2 166,771,714 (GRCm39) missense probably damaging 1.00
R5475:Cse1l UTSW 2 166,783,174 (GRCm39) missense probably damaging 1.00
R5493:Cse1l UTSW 2 166,783,110 (GRCm39) intron probably benign
R5782:Cse1l UTSW 2 166,770,921 (GRCm39) missense probably damaging 1.00
R5862:Cse1l UTSW 2 166,757,127 (GRCm39) missense probably benign 0.00
R6030:Cse1l UTSW 2 166,761,541 (GRCm39) missense probably benign 0.01
R6030:Cse1l UTSW 2 166,761,541 (GRCm39) missense probably benign 0.01
R6913:Cse1l UTSW 2 166,771,797 (GRCm39) missense possibly damaging 0.65
R7683:Cse1l UTSW 2 166,764,708 (GRCm39) missense probably benign
R7871:Cse1l UTSW 2 166,777,591 (GRCm39) splice site probably null
R8001:Cse1l UTSW 2 166,781,833 (GRCm39) missense probably damaging 1.00
R8057:Cse1l UTSW 2 166,781,845 (GRCm39) missense probably damaging 1.00
R8175:Cse1l UTSW 2 166,785,128 (GRCm39) critical splice donor site probably null
R8347:Cse1l UTSW 2 166,769,505 (GRCm39) missense possibly damaging 0.95
R8386:Cse1l UTSW 2 166,761,604 (GRCm39) missense probably benign 0.00
R8479:Cse1l UTSW 2 166,763,893 (GRCm39) missense possibly damaging 0.95
R8973:Cse1l UTSW 2 166,785,000 (GRCm39) missense probably damaging 1.00
R9206:Cse1l UTSW 2 166,783,185 (GRCm39) missense probably damaging 1.00
R9208:Cse1l UTSW 2 166,783,185 (GRCm39) missense probably damaging 1.00
R9522:Cse1l UTSW 2 166,776,673 (GRCm39) missense probably benign
R9599:Cse1l UTSW 2 166,783,386 (GRCm39) missense probably benign
R9600:Cse1l UTSW 2 166,757,119 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAGCATTTTATTCAGTAACGCAG -3'
(R):5'- GGACAAGCAGTTGACAGTTTG -3'

Sequencing Primer
(F):5'- TTACTGAGTAGCATTGGGGAACTCAC -3'
(R):5'- CAAGCAGTTGACAGTTTGTGAAG -3'
Posted On 2016-06-21