Incidental Mutation 'R5164:Pnisr'
ID395584
Institutional Source Beutler Lab
Gene Symbol Pnisr
Ensembl Gene ENSMUSG00000028248
Gene NamePNN interacting serine/arginine-rich
SynonymsSfrs18, 5730406M06Rik
MMRRC Submission 042745-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.954) question?
Stock #R5164 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location21847583-21876475 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 21859237 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 144 (Q144L)
Ref Sequence ENSEMBL: ENSMUSP00000139324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029911] [ENSMUST00000098238] [ENSMUST00000108229] [ENSMUST00000185001]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029911
AA Change: Q144L

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000029911
Gene: ENSMUSG00000028248
AA Change: Q144L

DomainStartEndE-ValueType
low complexity region 1 27 N/A INTRINSIC
internal_repeat_1 57 86 6.59e-5 PROSPERO
low complexity region 94 117 N/A INTRINSIC
internal_repeat_1 121 149 6.59e-5 PROSPERO
low complexity region 181 194 N/A INTRINSIC
Pfam:PNISR 223 391 1.1e-55 PFAM
low complexity region 429 449 N/A INTRINSIC
low complexity region 494 586 N/A INTRINSIC
low complexity region 592 640 N/A INTRINSIC
low complexity region 664 703 N/A INTRINSIC
low complexity region 746 783 N/A INTRINSIC
low complexity region 789 814 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000098238
AA Change: Q144L

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000095840
Gene: ENSMUSG00000028248
AA Change: Q144L

DomainStartEndE-ValueType
low complexity region 1 27 N/A INTRINSIC
internal_repeat_1 57 86 7.37e-5 PROSPERO
low complexity region 94 117 N/A INTRINSIC
internal_repeat_1 121 149 7.37e-5 PROSPERO
low complexity region 181 194 N/A INTRINSIC
coiled coil region 240 276 N/A INTRINSIC
low complexity region 289 298 N/A INTRINSIC
low complexity region 318 331 N/A INTRINSIC
low complexity region 334 347 N/A INTRINSIC
low complexity region 376 415 N/A INTRINSIC
low complexity region 429 449 N/A INTRINSIC
low complexity region 494 586 N/A INTRINSIC
low complexity region 592 640 N/A INTRINSIC
low complexity region 664 703 N/A INTRINSIC
low complexity region 746 783 N/A INTRINSIC
low complexity region 789 805 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108229
AA Change: Q144L

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103864
Gene: ENSMUSG00000028248
AA Change: Q144L

DomainStartEndE-ValueType
low complexity region 1 27 N/A INTRINSIC
low complexity region 94 117 N/A INTRINSIC
low complexity region 181 194 N/A INTRINSIC
coiled coil region 240 276 N/A INTRINSIC
low complexity region 289 298 N/A INTRINSIC
low complexity region 318 331 N/A INTRINSIC
low complexity region 334 347 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138419
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138681
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150368
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150927
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151621
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152666
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156136
Predicted Effect possibly damaging
Transcript: ENSMUST00000185001
AA Change: Q144L

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000139324
Gene: ENSMUSG00000028248
AA Change: Q144L

DomainStartEndE-ValueType
low complexity region 1 27 N/A INTRINSIC
low complexity region 94 117 N/A INTRINSIC
low complexity region 181 194 N/A INTRINSIC
coiled coil region 240 276 N/A INTRINSIC
low complexity region 289 298 N/A INTRINSIC
low complexity region 318 331 N/A INTRINSIC
low complexity region 334 347 N/A INTRINSIC
Meta Mutation Damage Score 0.0761 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (49/50)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,435,674 H4637Q probably benign Het
Akap6 A G 12: 53,142,466 H2221R probably benign Het
Arsj A T 3: 126,438,159 M185L probably benign Het
Ccdc177 T C 12: 80,758,562 T313A unknown Het
Cdkal1 A T 13: 29,625,719 L214H probably damaging Het
Cfap44 T A 16: 44,481,389 I1830N probably damaging Het
Cfap65 T C 1: 74,926,516 K445R probably damaging Het
Chrnb3 T A 8: 27,394,132 I299N probably damaging Het
Cse1l C A 2: 166,944,428 D826E probably benign Het
Cwf19l2 T C 9: 3,475,511 V816A probably damaging Het
Dnah5 A T 15: 28,408,292 E3474D probably benign Het
Dock5 A T 14: 67,817,661 Y585* probably null Het
Ebf2 T C 14: 67,390,521 S322P possibly damaging Het
Epha8 T C 4: 136,945,672 E267G possibly damaging Het
Fam126b T C 1: 58,535,438 T315A probably benign Het
Fkbp5 A G 17: 28,437,990 probably null Het
Gbp4 T A 5: 105,136,877 K49* probably null Het
Gm13212 T C 4: 145,622,205 Y71H probably damaging Het
Gramd4 A T 15: 86,100,831 T98S probably benign Het
H2-Ke6 A G 17: 34,026,978 probably benign Het
Hectd1 C A 12: 51,827,489 M1I probably null Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Keg1 A G 19: 12,714,680 probably benign Het
Lilra6 A T 7: 3,914,881 V88E probably damaging Het
Mast1 A G 8: 84,913,518 probably benign Het
Mdn1 A G 4: 32,759,011 probably null Het
Nrd1 C T 4: 109,039,717 T511I probably damaging Het
Olfr1058 T C 2: 86,385,471 T316A probably benign Het
Olfr1204 T A 2: 88,852,570 L207I probably benign Het
Olfr478 G A 7: 108,032,280 T21I possibly damaging Het
Pms1 A G 1: 53,207,640 V301A probably damaging Het
Pp2d1 G T 17: 53,508,070 T542K probably benign Het
Ppargc1b A T 18: 61,302,644 C922S probably damaging Het
Ptprd T C 4: 76,100,758 probably null Het
Runx3 T C 4: 135,121,130 S9P possibly damaging Het
Serpina1b A G 12: 103,732,087 S168P probably benign Het
Slc14a2 G A 18: 78,157,272 A722V probably damaging Het
Slc23a2 T A 2: 132,075,450 probably benign Het
Slc47a1 A G 11: 61,353,060 probably null Het
Tcf20 A G 15: 82,856,603 S216P probably damaging Het
Tpst1 T A 5: 130,102,001 I104N probably damaging Het
Ttc25 G A 11: 100,571,520 W506* probably null Het
Ufm1 A C 3: 53,857,927 probably benign Het
Unkl A G 17: 25,213,109 probably null Het
Usf3 T C 16: 44,218,180 S1008P probably damaging Het
Ythdf3 T C 3: 16,183,513 V6A possibly damaging Het
Zc3h3 A T 15: 75,777,026 S752R probably benign Het
Other mutations in Pnisr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Pnisr APN 4 21870407 critical splice donor site probably null
IGL01467:Pnisr APN 4 21874650 unclassified probably benign
IGL01997:Pnisr APN 4 21871537 missense possibly damaging 0.95
IGL02641:Pnisr APN 4 21860908 missense probably benign 0.03
IGL02756:Pnisr APN 4 21862175 missense probably benign 0.07
R0106:Pnisr UTSW 4 21874617 unclassified probably benign
R0106:Pnisr UTSW 4 21874617 unclassified probably benign
R0620:Pnisr UTSW 4 21874092 unclassified probably benign
R0636:Pnisr UTSW 4 21873800 unclassified probably benign
R1179:Pnisr UTSW 4 21865937 missense possibly damaging 0.95
R1388:Pnisr UTSW 4 21862041 missense possibly damaging 0.88
R1450:Pnisr UTSW 4 21874912 critical splice acceptor site probably null
R1609:Pnisr UTSW 4 21871440 nonsense probably null
R1663:Pnisr UTSW 4 21873857 unclassified probably benign
R1670:Pnisr UTSW 4 21865893 missense probably damaging 1.00
R1721:Pnisr UTSW 4 21874086 unclassified probably benign
R1792:Pnisr UTSW 4 21860968 missense possibly damaging 0.94
R1867:Pnisr UTSW 4 21874086 unclassified probably benign
R1868:Pnisr UTSW 4 21874086 unclassified probably benign
R1909:Pnisr UTSW 4 21869517 missense possibly damaging 0.88
R1931:Pnisr UTSW 4 21873612 missense probably benign 0.01
R4843:Pnisr UTSW 4 21857400 intron probably benign
R4917:Pnisr UTSW 4 21859330 intron probably benign
R5076:Pnisr UTSW 4 21874990 unclassified probably benign
R5227:Pnisr UTSW 4 21874587 unclassified probably benign
R6722:Pnisr UTSW 4 21859165 missense probably damaging 0.99
R7878:Pnisr UTSW 4 21874370 missense unknown
R7961:Pnisr UTSW 4 21874370 missense unknown
Z1088:Pnisr UTSW 4 21873684 missense probably benign
Z1176:Pnisr UTSW 4 21873684 missense probably benign
Z1177:Pnisr UTSW 4 21873684 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCCTGAATCCTGAATAGAATGGGG -3'
(R):5'- TGTCGGTACCAATTTCCTAATCAAG -3'

Sequencing Primer
(F):5'- TCCTGAATAGAATGGGGAATGCATC -3'
(R):5'- CTGATATGTGCAACCCTGACAATG -3'
Posted On2016-06-21