Incidental Mutation 'R5164:Gbp4'
ID395592
Institutional Source Beutler Lab
Gene Symbol Gbp4
Ensembl Gene ENSMUSG00000079363
Gene Nameguanylate binding protein 4
SynonymsMpa2, Mag-2, Mpa-2
MMRRC Submission 042745-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5164 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location105115767-105139586 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 105136877 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 49 (K49*)
Ref Sequence ENSEMBL: ENSMUSP00000142493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031235] [ENSMUST00000100961] [ENSMUST00000100962] [ENSMUST00000196204] [ENSMUST00000196677] [ENSMUST00000197799] [ENSMUST00000199629]
Predicted Effect probably benign
Transcript: ENSMUST00000031235
SMART Domains Protein: ENSMUSP00000031235
Gene: ENSMUSG00000034438

DomainStartEndE-ValueType
Pfam:GBP 16 213 5.4e-91 PFAM
Pfam:GBP_C 206 493 1e-115 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100961
SMART Domains Protein: ENSMUSP00000098521
Gene: ENSMUSG00000029298

DomainStartEndE-ValueType
Pfam:GBP 16 279 3.8e-124 PFAM
Pfam:GBP_C 281 575 4.5e-115 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000100962
AA Change: K49*
SMART Domains Protein: ENSMUSP00000098522
Gene: ENSMUSG00000079363
AA Change: K49*

DomainStartEndE-ValueType
Pfam:GBP 16 287 4.2e-91 PFAM
Pfam:GBP_C 289 583 4.4e-117 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000196204
AA Change: K49*
SMART Domains Protein: ENSMUSP00000142528
Gene: ENSMUSG00000079363
AA Change: K49*

DomainStartEndE-ValueType
Pfam:GBP 16 76 1e-19 PFAM
low complexity region 82 103 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196677
SMART Domains Protein: ENSMUSP00000142795
Gene: ENSMUSG00000079363

DomainStartEndE-ValueType
Pfam:GBP 1 149 3e-56 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000197799
AA Change: K49*
SMART Domains Protein: ENSMUSP00000142493
Gene: ENSMUSG00000079363
AA Change: K49*

DomainStartEndE-ValueType
Pfam:GBP 16 184 3.3e-59 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198278
Predicted Effect probably benign
Transcript: ENSMUST00000199629
SMART Domains Protein: ENSMUSP00000143689
Gene: ENSMUSG00000079363

DomainStartEndE-ValueType
Pfam:GBP 1 127 1.5e-43 PFAM
Meta Mutation Damage Score 0.9717 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (49/50)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,435,674 H4637Q probably benign Het
Akap6 A G 12: 53,142,466 H2221R probably benign Het
Arsj A T 3: 126,438,159 M185L probably benign Het
Ccdc177 T C 12: 80,758,562 T313A unknown Het
Cdkal1 A T 13: 29,625,719 L214H probably damaging Het
Cfap44 T A 16: 44,481,389 I1830N probably damaging Het
Cfap65 T C 1: 74,926,516 K445R probably damaging Het
Chrnb3 T A 8: 27,394,132 I299N probably damaging Het
Cse1l C A 2: 166,944,428 D826E probably benign Het
Cwf19l2 T C 9: 3,475,511 V816A probably damaging Het
Dnah5 A T 15: 28,408,292 E3474D probably benign Het
Dock5 A T 14: 67,817,661 Y585* probably null Het
Ebf2 T C 14: 67,390,521 S322P possibly damaging Het
Epha8 T C 4: 136,945,672 E267G possibly damaging Het
Fam126b T C 1: 58,535,438 T315A probably benign Het
Fkbp5 A G 17: 28,437,990 probably null Het
Gm13212 T C 4: 145,622,205 Y71H probably damaging Het
Gramd4 A T 15: 86,100,831 T98S probably benign Het
H2-Ke6 A G 17: 34,026,978 probably benign Het
Hectd1 C A 12: 51,827,489 M1I probably null Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Keg1 A G 19: 12,714,680 probably benign Het
Lilra6 A T 7: 3,914,881 V88E probably damaging Het
Mast1 A G 8: 84,913,518 probably benign Het
Mdn1 A G 4: 32,759,011 probably null Het
Nrd1 C T 4: 109,039,717 T511I probably damaging Het
Olfr1058 T C 2: 86,385,471 T316A probably benign Het
Olfr1204 T A 2: 88,852,570 L207I probably benign Het
Olfr478 G A 7: 108,032,280 T21I possibly damaging Het
Pms1 A G 1: 53,207,640 V301A probably damaging Het
Pnisr A T 4: 21,859,237 Q144L possibly damaging Het
Pp2d1 G T 17: 53,508,070 T542K probably benign Het
Ppargc1b A T 18: 61,302,644 C922S probably damaging Het
Ptprd T C 4: 76,100,758 probably null Het
Runx3 T C 4: 135,121,130 S9P possibly damaging Het
Serpina1b A G 12: 103,732,087 S168P probably benign Het
Slc14a2 G A 18: 78,157,272 A722V probably damaging Het
Slc23a2 T A 2: 132,075,450 probably benign Het
Slc47a1 A G 11: 61,353,060 probably null Het
Tcf20 A G 15: 82,856,603 S216P probably damaging Het
Tpst1 T A 5: 130,102,001 I104N probably damaging Het
Ttc25 G A 11: 100,571,520 W506* probably null Het
Ufm1 A C 3: 53,857,927 probably benign Het
Unkl A G 17: 25,213,109 probably null Het
Usf3 T C 16: 44,218,180 S1008P probably damaging Het
Ythdf3 T C 3: 16,183,513 V6A possibly damaging Het
Zc3h3 A T 15: 75,777,026 S752R probably benign Het
Other mutations in Gbp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01307:Gbp4 APN 5 105137021 start codon destroyed probably null 0.00
IGL01834:Gbp4 APN 5 105125602 missense probably damaging 1.00
IGL02100:Gbp4 APN 5 105122075 unclassified probably benign
IGL02119:Gbp4 APN 5 105121042 missense probably benign 0.14
IGL02364:Gbp4 APN 5 105136874 missense probably damaging 1.00
IGL03026:Gbp4 APN 5 105120000 missense possibly damaging 0.88
PIT4651001:Gbp4 UTSW 5 105118423 missense probably benign 0.08
R0147:Gbp4 UTSW 5 105119496 missense probably benign 0.17
R0148:Gbp4 UTSW 5 105119496 missense probably benign 0.17
R0413:Gbp4 UTSW 5 105121106 missense possibly damaging 0.85
R0415:Gbp4 UTSW 5 105121106 missense possibly damaging 0.85
R0478:Gbp4 UTSW 5 105119433 missense probably benign 0.01
R0546:Gbp4 UTSW 5 105120970 missense probably damaging 1.00
R0638:Gbp4 UTSW 5 105121840 missense probably damaging 0.98
R1528:Gbp4 UTSW 5 105121792 splice site probably null
R1541:Gbp4 UTSW 5 105118409 missense probably benign
R2099:Gbp4 UTSW 5 105121081 missense probably damaging 1.00
R2112:Gbp4 UTSW 5 105135176 missense possibly damaging 0.95
R2994:Gbp4 UTSW 5 105137020 start codon destroyed probably null 0.86
R4021:Gbp4 UTSW 5 105120923 missense probably damaging 0.96
R4258:Gbp4 UTSW 5 105136975 missense probably damaging 1.00
R4489:Gbp4 UTSW 5 105121907 missense probably damaging 1.00
R5195:Gbp4 UTSW 5 105119532 missense probably benign 0.00
R5406:Gbp4 UTSW 5 105119521 missense possibly damaging 0.76
R5550:Gbp4 UTSW 5 105122045 missense probably damaging 1.00
R5701:Gbp4 UTSW 5 105118399 missense possibly damaging 0.60
R5814:Gbp4 UTSW 5 105119919 missense probably benign 0.27
R6128:Gbp4 UTSW 5 105135164 missense possibly damaging 0.93
R6307:Gbp4 UTSW 5 105123109 nonsense probably null
R6513:Gbp4 UTSW 5 105123120 missense possibly damaging 0.69
R6870:Gbp4 UTSW 5 105125578 missense probably damaging 1.00
R6938:Gbp4 UTSW 5 105135077 missense probably damaging 0.99
R7063:Gbp4 UTSW 5 105118448 missense probably damaging 0.96
R7124:Gbp4 UTSW 5 105119959 missense possibly damaging 0.45
R7457:Gbp4 UTSW 5 105119553 missense probably damaging 0.98
R7615:Gbp4 UTSW 5 105122982 missense possibly damaging 0.95
R7877:Gbp4 UTSW 5 105118295 missense probably benign 0.34
R7905:Gbp4 UTSW 5 105121087 missense probably damaging 1.00
R8274:Gbp4 UTSW 5 105119472 missense probably benign 0.01
R8377:Gbp4 UTSW 5 105118462 missense probably benign 0.02
R8414:Gbp4 UTSW 5 105136837 missense probably benign 0.05
R8423:Gbp4 UTSW 5 105119934 missense probably damaging 1.00
S24628:Gbp4 UTSW 5 105121106 missense possibly damaging 0.85
X0067:Gbp4 UTSW 5 105125625 missense probably damaging 0.98
Z1088:Gbp4 UTSW 5 105120997 missense probably damaging 1.00
Z1177:Gbp4 UTSW 5 105119449 nonsense probably null
Z1177:Gbp4 UTSW 5 105125135 missense probably null 0.89
Predicted Primers PCR Primer
(F):5'- TCTTGAGCATTCCTAGGGGAG -3'
(R):5'- AGCCATTGGGTGTCAGTGAG -3'

Sequencing Primer
(F):5'- AGCATTCCTAGGGGAGATTTTC -3'
(R):5'- GGCAGAGAATGACTTTACTCTCTTTC -3'
Posted On2016-06-21