Incidental Mutation 'R5164:Ttc25'
ID395603
Institutional Source Beutler Lab
Gene Symbol Ttc25
Ensembl Gene ENSMUSG00000006784
Gene Nametetratricopeptide repeat domain 25
Synonyms
MMRRC Submission 042745-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R5164 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location100545607-100572568 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 100571520 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 506 (W506*)
Ref Sequence ENSEMBL: ENSMUSP00000006976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006976] [ENSMUST00000092684] [ENSMUST00000103120]
Predicted Effect probably null
Transcript: ENSMUST00000006976
AA Change: W506*
SMART Domains Protein: ENSMUSP00000006976
Gene: ENSMUSG00000006784
AA Change: W506*

DomainStartEndE-ValueType
TPR 11 44 3.69e1 SMART
TPR 45 78 3.07e1 SMART
TPR 79 112 4.96e0 SMART
low complexity region 147 158 N/A INTRINSIC
low complexity region 191 208 N/A INTRINSIC
TPR 318 351 4.96e0 SMART
TPR 358 391 1.11e1 SMART
Blast:TPR 395 428 7e-14 BLAST
TPR 435 468 2.99e1 SMART
low complexity region 493 505 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092684
AA Change: V535M

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000090355
Gene: ENSMUSG00000006784
AA Change: V535M

DomainStartEndE-ValueType
TPR 11 44 3.69e1 SMART
TPR 45 78 3.07e1 SMART
TPR 79 112 4.96e0 SMART
low complexity region 147 158 N/A INTRINSIC
low complexity region 191 208 N/A INTRINSIC
TPR 318 351 4.96e0 SMART
TPR 358 391 1.11e1 SMART
Blast:TPR 395 428 5e-14 BLAST
TPR 435 468 2.99e1 SMART
coiled coil region 528 548 N/A INTRINSIC
low complexity region 556 567 N/A INTRINSIC
coiled coil region 599 624 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103120
SMART Domains Protein: ENSMUSP00000099409
Gene: ENSMUSG00000006782

DomainStartEndE-ValueType
Pfam:AAA_33 52 175 8.9e-10 PFAM
Pfam:CNPase 185 419 7.1e-118 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132143
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147403
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148034
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150414
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (49/50)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display partial preweaning lethality, impaired ciliary motility, and a variety of left-right body symmetry defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,435,674 H4637Q probably benign Het
Akap6 A G 12: 53,142,466 H2221R probably benign Het
Arsj A T 3: 126,438,159 M185L probably benign Het
Ccdc177 T C 12: 80,758,562 T313A unknown Het
Cdkal1 A T 13: 29,625,719 L214H probably damaging Het
Cfap44 T A 16: 44,481,389 I1830N probably damaging Het
Cfap65 T C 1: 74,926,516 K445R probably damaging Het
Chrnb3 T A 8: 27,394,132 I299N probably damaging Het
Cse1l C A 2: 166,944,428 D826E probably benign Het
Cwf19l2 T C 9: 3,475,511 V816A probably damaging Het
Dnah5 A T 15: 28,408,292 E3474D probably benign Het
Dock5 A T 14: 67,817,661 Y585* probably null Het
Ebf2 T C 14: 67,390,521 S322P possibly damaging Het
Epha8 T C 4: 136,945,672 E267G possibly damaging Het
Fam126b T C 1: 58,535,438 T315A probably benign Het
Fkbp5 A G 17: 28,437,990 probably null Het
Gbp4 T A 5: 105,136,877 K49* probably null Het
Gm13212 T C 4: 145,622,205 Y71H probably damaging Het
Gramd4 A T 15: 86,100,831 T98S probably benign Het
H2-Ke6 A G 17: 34,026,978 probably benign Het
Hectd1 C A 12: 51,827,489 M1I probably null Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Keg1 A G 19: 12,714,680 probably benign Het
Lilra6 A T 7: 3,914,881 V88E probably damaging Het
Mast1 A G 8: 84,913,518 probably benign Het
Mdn1 A G 4: 32,759,011 probably null Het
Nrd1 C T 4: 109,039,717 T511I probably damaging Het
Olfr1058 T C 2: 86,385,471 T316A probably benign Het
Olfr1204 T A 2: 88,852,570 L207I probably benign Het
Olfr478 G A 7: 108,032,280 T21I possibly damaging Het
Pms1 A G 1: 53,207,640 V301A probably damaging Het
Pnisr A T 4: 21,859,237 Q144L possibly damaging Het
Pp2d1 G T 17: 53,508,070 T542K probably benign Het
Ppargc1b A T 18: 61,302,644 C922S probably damaging Het
Ptprd T C 4: 76,100,758 probably null Het
Runx3 T C 4: 135,121,130 S9P possibly damaging Het
Serpina1b A G 12: 103,732,087 S168P probably benign Het
Slc14a2 G A 18: 78,157,272 A722V probably damaging Het
Slc23a2 T A 2: 132,075,450 probably benign Het
Slc47a1 A G 11: 61,353,060 probably null Het
Tcf20 A G 15: 82,856,603 S216P probably damaging Het
Tpst1 T A 5: 130,102,001 I104N probably damaging Het
Ufm1 A C 3: 53,857,927 probably benign Het
Unkl A G 17: 25,213,109 probably null Het
Usf3 T C 16: 44,218,180 S1008P probably damaging Het
Ythdf3 T C 3: 16,183,513 V6A possibly damaging Het
Zc3h3 A T 15: 75,777,026 S752R probably benign Het
Other mutations in Ttc25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02027:Ttc25 APN 11 100569902 missense probably damaging 1.00
IGL02379:Ttc25 APN 11 100566983 missense possibly damaging 0.87
IGL03091:Ttc25 APN 11 100550250 nonsense probably null
IGL02991:Ttc25 UTSW 11 100553872 missense probably benign 0.01
R0044:Ttc25 UTSW 11 100567001 missense probably damaging 1.00
R0137:Ttc25 UTSW 11 100563568 missense probably damaging 1.00
R0280:Ttc25 UTSW 11 100550265 missense probably damaging 1.00
R1373:Ttc25 UTSW 11 100545832 missense probably damaging 1.00
R1793:Ttc25 UTSW 11 100569853 splice site probably null
R2097:Ttc25 UTSW 11 100563582 missense possibly damaging 0.89
R2121:Ttc25 UTSW 11 100567011 critical splice donor site probably null
R2509:Ttc25 UTSW 11 100553535 missense probably damaging 0.99
R2655:Ttc25 UTSW 11 100553579 missense probably damaging 1.00
R4635:Ttc25 UTSW 11 100551507 nonsense probably null
R4773:Ttc25 UTSW 11 100549916 missense probably benign 0.05
R4858:Ttc25 UTSW 11 100550321 missense probably damaging 0.96
R5181:Ttc25 UTSW 11 100549893 missense probably damaging 1.00
R5707:Ttc25 UTSW 11 100554061 missense probably damaging 0.99
R5742:Ttc25 UTSW 11 100545873 missense possibly damaging 0.90
R7634:Ttc25 UTSW 11 100561905 critical splice donor site probably null
X0018:Ttc25 UTSW 11 100553598 missense probably damaging 0.99
X0028:Ttc25 UTSW 11 100545898 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCCAGCGGTGTGACATATGC -3'
(R):5'- AGTAGTCCGAGAGCCTTCTG -3'

Sequencing Primer
(F):5'- CTCCCTTGGAAAGAGTGTGAC -3'
(R):5'- AGTCCGAGAGCCTTCTGTAGATTTC -3'
Posted On2016-06-21