Incidental Mutation 'R5164:Keg1'
ID 395625
Institutional Source Beutler Lab
Gene Symbol Keg1
Ensembl Gene ENSMUSG00000024694
Gene Name kidney expressed gene 1
Synonyms 0610008P16Rik, GS4059
MMRRC Submission 042745-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock # R5164 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 12695786-12719902 bp(+) (GRCm38)
Type of Mutation intron
DNA Base Change (assembly) A to G at 12714680 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025598] [ENSMUST00000138545] [ENSMUST00000154822]
AlphaFold Q9DCY0
Predicted Effect probably benign
Transcript: ENSMUST00000025598
SMART Domains Protein: ENSMUSP00000025598
Gene: ENSMUSG00000024694

DomainStartEndE-ValueType
Pfam:Gly_acyl_tr_N 1 205 1.2e-89 PFAM
Pfam:Gly_acyl_tr_C 206 294 1.9e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123407
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124184
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125496
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128987
Predicted Effect probably benign
Transcript: ENSMUST00000138545
SMART Domains Protein: ENSMUSP00000116555
Gene: ENSMUSG00000024694

DomainStartEndE-ValueType
Pfam:Gly_acyl_tr_N 1 195 4.2e-96 PFAM
Pfam:Gly_acyl_tr_C 196 228 4.3e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147335
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152017
Predicted Effect probably benign
Transcript: ENSMUST00000154822
SMART Domains Protein: ENSMUSP00000119879
Gene: ENSMUSG00000024694

DomainStartEndE-ValueType
Pfam:Gly_acyl_tr_N 1 156 1.2e-71 PFAM
Pfam:Gly_acyl_tr_C 153 221 3.2e-37 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (49/50)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,435,674 H4637Q probably benign Het
Akap6 A G 12: 53,142,466 H2221R probably benign Het
Arsj A T 3: 126,438,159 M185L probably benign Het
Ccdc177 T C 12: 80,758,562 T313A unknown Het
Cdkal1 A T 13: 29,625,719 L214H probably damaging Het
Cfap44 T A 16: 44,481,389 I1830N probably damaging Het
Cfap65 T C 1: 74,926,516 K445R probably damaging Het
Chrnb3 T A 8: 27,394,132 I299N probably damaging Het
Cse1l C A 2: 166,944,428 D826E probably benign Het
Cwf19l2 T C 9: 3,475,511 V816A probably damaging Het
Dnah5 A T 15: 28,408,292 E3474D probably benign Het
Dock5 A T 14: 67,817,661 Y585* probably null Het
Ebf2 T C 14: 67,390,521 S322P possibly damaging Het
Epha8 T C 4: 136,945,672 E267G possibly damaging Het
Fam126b T C 1: 58,535,438 T315A probably benign Het
Fkbp5 A G 17: 28,437,990 probably null Het
Gbp4 T A 5: 105,136,877 K49* probably null Het
Gm13212 T C 4: 145,622,205 Y71H probably damaging Het
Gramd4 A T 15: 86,100,831 T98S probably benign Het
H2-Ke6 A G 17: 34,026,978 probably benign Het
Hectd1 C A 12: 51,827,489 M1I probably null Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Lilra6 A T 7: 3,914,881 V88E probably damaging Het
Mast1 A G 8: 84,913,518 probably benign Het
Mdn1 A G 4: 32,759,011 probably null Het
Nrd1 C T 4: 109,039,717 T511I probably damaging Het
Olfr1058 T C 2: 86,385,471 T316A probably benign Het
Olfr1204 T A 2: 88,852,570 L207I probably benign Het
Olfr478 G A 7: 108,032,280 T21I possibly damaging Het
Pms1 A G 1: 53,207,640 V301A probably damaging Het
Pnisr A T 4: 21,859,237 Q144L possibly damaging Het
Pp2d1 G T 17: 53,508,070 T542K probably benign Het
Ppargc1b A T 18: 61,302,644 C922S probably damaging Het
Ptprd T C 4: 76,100,758 probably null Het
Runx3 T C 4: 135,121,130 S9P possibly damaging Het
Serpina1b A G 12: 103,732,087 S168P probably benign Het
Slc14a2 G A 18: 78,157,272 A722V probably damaging Het
Slc23a2 T A 2: 132,075,450 probably benign Het
Slc47a1 A G 11: 61,353,060 probably null Het
Tcf20 A G 15: 82,856,603 S216P probably damaging Het
Tpst1 T A 5: 130,102,001 I104N probably damaging Het
Ttc25 G A 11: 100,571,520 W506* probably null Het
Ufm1 A C 3: 53,857,927 probably benign Het
Unkl A G 17: 25,213,109 probably null Het
Usf3 T C 16: 44,218,180 S1008P probably damaging Het
Ythdf3 T C 3: 16,183,513 V6A possibly damaging Het
Zc3h3 A T 15: 75,777,026 S752R probably benign Het
Other mutations in Keg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01071:Keg1 APN 19 12719000 missense probably damaging 1.00
IGL01084:Keg1 APN 19 12714612 missense probably damaging 1.00
IGL02563:Keg1 APN 19 12719157 missense probably damaging 1.00
IGL03328:Keg1 APN 19 12719097 missense probably damaging 1.00
R0103:Keg1 UTSW 19 12718916 missense possibly damaging 0.79
R0103:Keg1 UTSW 19 12718916 missense possibly damaging 0.79
R0417:Keg1 UTSW 19 12711060 missense probably damaging 1.00
R1300:Keg1 UTSW 19 12719004 missense probably damaging 0.98
R1476:Keg1 UTSW 19 12716023 missense probably benign
R1482:Keg1 UTSW 19 12718821 missense probably damaging 1.00
R1643:Keg1 UTSW 19 12719042 missense probably benign 0.00
R4002:Keg1 UTSW 19 12718943 missense possibly damaging 0.95
R5022:Keg1 UTSW 19 12719157 missense probably damaging 1.00
R5386:Keg1 UTSW 19 12714538 missense probably damaging 1.00
R6289:Keg1 UTSW 19 12714573 missense probably damaging 0.98
R6517:Keg1 UTSW 19 12715910 missense probably benign 0.00
R6656:Keg1 UTSW 19 12709630 nonsense probably null
R7117:Keg1 UTSW 19 12709678 missense probably damaging 1.00
R7676:Keg1 UTSW 19 12716045 missense probably benign 0.00
R7807:Keg1 UTSW 19 12714634 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CATGACAGATGACCTTGACCAC -3'
(R):5'- ACAACTCCAGAAGCTATAGTCTTG -3'

Sequencing Primer
(F):5'- TGACAGATGACCTTGACCACTACAAC -3'
(R):5'- CTCCAGAAGCTATAGTCTTGTTTAC -3'
Posted On 2016-06-21