Incidental Mutation 'R5165:Mettl11b'
ID395628
Institutional Source Beutler Lab
Gene Symbol Mettl11b
Ensembl Gene ENSMUSG00000040113
Gene Namemethyltransferase like 11B
SynonymsLOC240879
MMRRC Submission 042746-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R5165 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location163702256-163725232 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 163722523 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 53 (I53T)
Ref Sequence ENSEMBL: ENSMUSP00000124700 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159679] [ENSMUST00000160495]
Predicted Effect probably benign
Transcript: ENSMUST00000159679
SMART Domains Protein: ENSMUSP00000124211
Gene: ENSMUSG00000040113

DomainStartEndE-ValueType
Pfam:Methyltransf_PK 64 278 5.7e-74 PFAM
Pfam:Methyltransf_11 121 220 4.1e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160495
AA Change: I53T

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 98% (58/59)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actg2 T A 6: 83,526,832 I77F probably benign Het
Actl6a G A 3: 32,720,208 V285I probably benign Het
Adam9 A T 8: 24,967,174 I646N possibly damaging Het
Ahnak T C 19: 9,015,665 I4771T possibly damaging Het
Alas1 T C 9: 106,241,255 T223A probably damaging Het
Apc2 A G 10: 80,315,850 E2246G probably damaging Het
Atp1a1 A G 3: 101,581,789 I795T probably benign Het
Cdhr4 T C 9: 107,997,630 L633P probably damaging Het
Cep350 A G 1: 155,928,368 S990P probably damaging Het
Cplx2 A G 13: 54,378,976 I66V possibly damaging Het
Cx3cl1 T C 8: 94,779,876 S170P probably benign Het
Cyth1 T C 11: 118,169,082 N353S possibly damaging Het
Dapp1 T C 3: 137,939,215 probably null Het
Dmwd G A 7: 19,078,035 probably benign Het
Dsg1c A G 18: 20,277,023 H516R probably damaging Het
Efemp2 T C 19: 5,475,411 C39R probably damaging Het
Fnbp4 C G 2: 90,777,657 Q908E possibly damaging Het
Foxred2 A G 15: 77,956,012 V26A probably damaging Het
Gkap1 A G 13: 58,263,196 probably null Het
Gstcd A C 3: 133,084,679 V109G probably damaging Het
Hoxc9 T A 15: 102,984,000 M215K probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kcnj9 A T 1: 172,323,157 D296E probably benign Het
Kctd18 T C 1: 57,959,236 Y68C probably damaging Het
Kif21a A T 15: 90,956,376 M1179K probably benign Het
Lrfn5 T C 12: 61,839,624 I66T possibly damaging Het
Lrp12 A G 15: 39,872,461 S692P probably benign Het
Lrrc10 A T 10: 117,046,060 N213I probably benign Het
Nceh1 G A 3: 27,241,528 V313I probably benign Het
Nkx6-3 T A 8: 23,153,743 H53Q probably damaging Het
Nov A G 15: 54,749,189 D198G probably damaging Het
Olfr1276 T A 2: 111,257,223 V36E possibly damaging Het
Olfr128 A G 17: 37,924,361 D265G probably benign Het
Olfr1388 A G 11: 49,444,376 H175R probably damaging Het
Olfr1447 A T 19: 12,901,200 N193K probably benign Het
Oxct1 A T 15: 4,053,769 T157S possibly damaging Het
Pcdhga3 A G 18: 37,675,670 E392G possibly damaging Het
Polr1a T G 6: 71,967,925 Y1322D probably damaging Het
Prkdc T A 16: 15,678,272 S776T probably damaging Het
Ralgapb A G 2: 158,465,912 I1047V possibly damaging Het
Sertad4 A T 1: 192,846,822 S229T possibly damaging Het
Shank2 T A 7: 144,409,636 V327D possibly damaging Het
Skint6 A T 4: 112,865,668 V904E possibly damaging Het
Slfn8 A T 11: 83,017,127 Y197N probably damaging Het
Smo T A 6: 29,736,078 L23Q unknown Het
Snx29 T A 16: 11,420,775 M23K probably damaging Het
Synrg T C 11: 83,990,935 S366P probably benign Het
Tomm40 A G 7: 19,713,667 probably null Het
Tpcn1 T C 5: 120,557,945 E81G probably damaging Het
Trappc1 A G 11: 69,324,234 Q26R probably benign Het
Ttn T A 2: 76,776,556 probably null Het
Usp25 T A 16: 77,076,405 D450E possibly damaging Het
Zmynd19 T A 2: 24,958,189 Y132* probably null Het
Other mutations in Mettl11b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01729:Mettl11b APN 1 163725003 missense probably damaging 1.00
IGL01973:Mettl11b APN 1 163717120 missense probably benign 0.00
IGL02418:Mettl11b APN 1 163703156 missense probably damaging 1.00
IGL02597:Mettl11b APN 1 163717087 missense probably benign 0.00
IGL03060:Mettl11b APN 1 163717123 missense probably damaging 1.00
IGL03162:Mettl11b APN 1 163703214 missense probably damaging 0.98
R4569:Mettl11b UTSW 1 163703017 makesense probably null
R4618:Mettl11b UTSW 1 163725028 missense probably damaging 1.00
R4888:Mettl11b UTSW 1 163703064 missense probably benign 0.11
R6353:Mettl11b UTSW 1 163704111 missense possibly damaging 0.94
R6503:Mettl11b UTSW 1 163704146 missense probably damaging 1.00
R7726:Mettl11b UTSW 1 163703184 missense probably benign 0.27
R8092:Mettl11b UTSW 1 163717250 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAACCATCTCTAAACAGCAATGG -3'
(R):5'- ATTCTGGTAATTCGGCCTGG -3'

Sequencing Primer
(F):5'- CCATCTCTAAACAGCAATGGATTTTC -3'
(R):5'- CTGGTAATTCGGCCTGGGTATTAG -3'
Posted On2016-06-21