Incidental Mutation 'R5165:Fnbp4'
ID395634
Institutional Source Beutler Lab
Gene Symbol Fnbp4
Ensembl Gene ENSMUSG00000008200
Gene Nameformin binding protein 4
SynonymsFBP30
MMRRC Submission 042746-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.920) question?
Stock #R5165 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location90745370-90781021 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 90777657 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Glutamic Acid at position 908 (Q908E)
Ref Sequence ENSEMBL: ENSMUSP00000013759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013759]
Predicted Effect possibly damaging
Transcript: ENSMUST00000013759
AA Change: Q908E

PolyPhen 2 Score 0.647 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000013759
Gene: ENSMUSG00000008200
AA Change: Q908E

DomainStartEndE-ValueType
low complexity region 65 140 N/A INTRINSIC
low complexity region 165 175 N/A INTRINSIC
low complexity region 204 235 N/A INTRINSIC
WW 265 298 3.58e-5 SMART
low complexity region 372 381 N/A INTRINSIC
low complexity region 386 393 N/A INTRINSIC
low complexity region 404 416 N/A INTRINSIC
coiled coil region 442 478 N/A INTRINSIC
low complexity region 515 533 N/A INTRINSIC
WW 650 683 1.77e-9 SMART
low complexity region 757 788 N/A INTRINSIC
low complexity region 891 909 N/A INTRINSIC
low complexity region 955 1002 N/A INTRINSIC
low complexity region 1018 1032 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123314
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123955
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135592
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141672
Meta Mutation Damage Score 0.1005 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 98% (58/59)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actg2 T A 6: 83,526,832 I77F probably benign Het
Actl6a G A 3: 32,720,208 V285I probably benign Het
Adam9 A T 8: 24,967,174 I646N possibly damaging Het
Ahnak T C 19: 9,015,665 I4771T possibly damaging Het
Alas1 T C 9: 106,241,255 T223A probably damaging Het
Apc2 A G 10: 80,315,850 E2246G probably damaging Het
Atp1a1 A G 3: 101,581,789 I795T probably benign Het
Cdhr4 T C 9: 107,997,630 L633P probably damaging Het
Cep350 A G 1: 155,928,368 S990P probably damaging Het
Cplx2 A G 13: 54,378,976 I66V possibly damaging Het
Cx3cl1 T C 8: 94,779,876 S170P probably benign Het
Cyth1 T C 11: 118,169,082 N353S possibly damaging Het
Dapp1 T C 3: 137,939,215 probably null Het
Dmwd G A 7: 19,078,035 probably benign Het
Dsg1c A G 18: 20,277,023 H516R probably damaging Het
Efemp2 T C 19: 5,475,411 C39R probably damaging Het
Foxred2 A G 15: 77,956,012 V26A probably damaging Het
Gkap1 A G 13: 58,263,196 probably null Het
Gstcd A C 3: 133,084,679 V109G probably damaging Het
Hoxc9 T A 15: 102,984,000 M215K probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kcnj9 A T 1: 172,323,157 D296E probably benign Het
Kctd18 T C 1: 57,959,236 Y68C probably damaging Het
Kif21a A T 15: 90,956,376 M1179K probably benign Het
Lrfn5 T C 12: 61,839,624 I66T possibly damaging Het
Lrp12 A G 15: 39,872,461 S692P probably benign Het
Lrrc10 A T 10: 117,046,060 N213I probably benign Het
Mettl11b A G 1: 163,722,523 I53T probably benign Het
Nceh1 G A 3: 27,241,528 V313I probably benign Het
Nkx6-3 T A 8: 23,153,743 H53Q probably damaging Het
Nov A G 15: 54,749,189 D198G probably damaging Het
Olfr1276 T A 2: 111,257,223 V36E possibly damaging Het
Olfr128 A G 17: 37,924,361 D265G probably benign Het
Olfr1388 A G 11: 49,444,376 H175R probably damaging Het
Olfr1447 A T 19: 12,901,200 N193K probably benign Het
Oxct1 A T 15: 4,053,769 T157S possibly damaging Het
Pcdhga3 A G 18: 37,675,670 E392G possibly damaging Het
Polr1a T G 6: 71,967,925 Y1322D probably damaging Het
Prkdc T A 16: 15,678,272 S776T probably damaging Het
Ralgapb A G 2: 158,465,912 I1047V possibly damaging Het
Sertad4 A T 1: 192,846,822 S229T possibly damaging Het
Shank2 T A 7: 144,409,636 V327D possibly damaging Het
Skint6 A T 4: 112,865,668 V904E possibly damaging Het
Slfn8 A T 11: 83,017,127 Y197N probably damaging Het
Smo T A 6: 29,736,078 L23Q unknown Het
Snx29 T A 16: 11,420,775 M23K probably damaging Het
Synrg T C 11: 83,990,935 S366P probably benign Het
Tomm40 A G 7: 19,713,667 probably null Het
Tpcn1 T C 5: 120,557,945 E81G probably damaging Het
Trappc1 A G 11: 69,324,234 Q26R probably benign Het
Ttn T A 2: 76,776,556 probably null Het
Usp25 T A 16: 77,076,405 D450E possibly damaging Het
Zmynd19 T A 2: 24,958,189 Y132* probably null Het
Other mutations in Fnbp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Fnbp4 APN 2 90751622 splice site probably benign
IGL00731:Fnbp4 APN 2 90768643 missense probably benign
IGL01021:Fnbp4 APN 2 90777669 missense probably benign 0.06
IGL01097:Fnbp4 APN 2 90776350 missense possibly damaging 0.63
IGL02504:Fnbp4 APN 2 90768543 missense probably damaging 1.00
IGL02510:Fnbp4 APN 2 90751475 missense probably benign
IGL02673:Fnbp4 APN 2 90763472 missense probably benign 0.01
IGL03024:Fnbp4 APN 2 90751179 missense probably benign 0.11
IGL03221:Fnbp4 APN 2 90777718 missense possibly damaging 0.65
R0570:Fnbp4 UTSW 2 90752957 missense probably damaging 1.00
R1914:Fnbp4 UTSW 2 90779193 unclassified probably benign
R1925:Fnbp4 UTSW 2 90765843 missense probably damaging 1.00
R2051:Fnbp4 UTSW 2 90757532 missense probably benign 0.05
R2069:Fnbp4 UTSW 2 90758372 missense probably damaging 1.00
R2165:Fnbp4 UTSW 2 90767399 splice site probably null
R2262:Fnbp4 UTSW 2 90757404 missense probably damaging 1.00
R3836:Fnbp4 UTSW 2 90746785 missense probably damaging 1.00
R4077:Fnbp4 UTSW 2 90758477 nonsense probably null
R4356:Fnbp4 UTSW 2 90758339 missense probably damaging 1.00
R4401:Fnbp4 UTSW 2 90746758 missense possibly damaging 0.62
R4491:Fnbp4 UTSW 2 90752968 critical splice donor site probably null
R4914:Fnbp4 UTSW 2 90751169 missense probably benign 0.00
R4981:Fnbp4 UTSW 2 90765830 missense probably damaging 1.00
R5272:Fnbp4 UTSW 2 90753115 missense probably benign
R5683:Fnbp4 UTSW 2 90752862 missense probably damaging 1.00
R5860:Fnbp4 UTSW 2 90757482 missense probably benign 0.00
R5905:Fnbp4 UTSW 2 90751134 missense probably benign 0.29
R5914:Fnbp4 UTSW 2 90774793 intron probably benign
R6028:Fnbp4 UTSW 2 90751134 missense probably benign 0.29
R6270:Fnbp4 UTSW 2 90757463 missense probably damaging 1.00
R6379:Fnbp4 UTSW 2 90751124 missense probably benign 0.41
R6389:Fnbp4 UTSW 2 90745535 missense unknown
R6883:Fnbp4 UTSW 2 90745828 critical splice donor site probably null
R6940:Fnbp4 UTSW 2 90745514 missense unknown
R7242:Fnbp4 UTSW 2 90745796 missense unknown
R7393:Fnbp4 UTSW 2 90779316 missense probably damaging 0.99
R7454:Fnbp4 UTSW 2 90777815 unclassified probably benign
R7455:Fnbp4 UTSW 2 90777815 unclassified probably benign
R8051:Fnbp4 UTSW 2 90777739 missense possibly damaging 0.77
R8283:Fnbp4 UTSW 2 90746771 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAGCTACCCTTAAACATTTGCATG -3'
(R):5'- GAAGAAGACTCACCTTATCTTTCTTCC -3'

Sequencing Primer
(F):5'- TAACAGAGCCTTGGCTGTC -3'
(R):5'- TCTCGTCTTCTCGGGCGG -3'
Posted On2016-06-21